Incidental Mutation 'R1515:Dmtf1'
ID168214
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Namecyclin D binding myb-like transcription factor 1
SynonymsDmp1
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location9118801-9161776 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 9140384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184372] [ENSMUST00000184372] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]
Predicted Effect probably null
Transcript: ENSMUST00000071921
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095017
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183448
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183792
Predicted Effect probably null
Transcript: ENSMUST00000183973
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183973
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184120
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184159
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184401
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184620
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184888
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184947
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9136070 missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9120056 missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9121853 missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9130381 missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9136098 missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9140474 missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9124435 intron probably benign
R0149:Dmtf1 UTSW 5 9132571 missense probably damaging 1.00
R0466:Dmtf1 UTSW 5 9132454 critical splice donor site probably null
R0825:Dmtf1 UTSW 5 9130388 missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0974:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9136109 missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9140383 splice site probably null
R1478:Dmtf1 UTSW 5 9121404 missense possibly damaging 0.93
R1861:Dmtf1 UTSW 5 9120347 splice site probably null
R1898:Dmtf1 UTSW 5 9128091 missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9129323 missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9129316 missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9132454 intron probably benign
R4467:Dmtf1 UTSW 5 9136085 missense probably damaging 1.00
R4490:Dmtf1 UTSW 5 9140379 intron probably benign
R4491:Dmtf1 UTSW 5 9140379 intron probably benign
R5007:Dmtf1 UTSW 5 9122439 unclassified probably benign
R5173:Dmtf1 UTSW 5 9140356 intron probably benign
R5184:Dmtf1 UTSW 5 9126641 missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9124515 missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9122415 unclassified probably benign
R5977:Dmtf1 UTSW 5 9140451 missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9126656 missense probably benign
R6887:Dmtf1 UTSW 5 9137149 missense probably damaging 1.00
R6921:Dmtf1 UTSW 5 9130654 intron probably benign
R7242:Dmtf1 UTSW 5 9149016 missense possibly damaging 0.90
R7706:Dmtf1 UTSW 5 9124489 missense possibly damaging 0.86
R7721:Dmtf1 UTSW 5 9126564 missense probably damaging 1.00
R7739:Dmtf1 UTSW 5 9140453 missense probably damaging 1.00
R7742:Dmtf1 UTSW 5 9122457 unclassified probably benign
R7859:Dmtf1 UTSW 5 9128044 missense probably damaging 1.00
R7883:Dmtf1 UTSW 5 9140397 missense probably benign 0.35
R7975:Dmtf1 UTSW 5 9129169 missense probably damaging 1.00
R8269:Dmtf1 UTSW 5 9132500 nonsense probably null
R8479:Dmtf1 UTSW 5 9120428 missense probably damaging 0.97
R8782:Dmtf1 UTSW 5 9129168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGACACAGATGAAGGTACATCC -3'
(R):5'- AGTGTCACCCAACATAATGTCTTGTCC -3'

Sequencing Primer
(F):5'- CAGATGAAGGTACATCCATTACTTCC -3'
(R):5'- CCATGAAAGGAGTTTCCTACCTGG -3'
Posted On2014-04-13