Incidental Mutation 'R1515:Dmtf1'
ID 168214
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Name cyclin D binding myb like transcription factor 1
Synonyms Dmp1
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.542) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 9168868-9211821 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 9190384 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184372] [ENSMUST00000184372] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]
AlphaFold Q8CE22
Predicted Effect probably null
Transcript: ENSMUST00000071921
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095017
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183448
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183792
Predicted Effect probably null
Transcript: ENSMUST00000183973
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183973
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184120
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184159
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184401
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184620
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184888
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184903
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dnhd1 A G 7: 105,353,355 (GRCm39) N2836S probably benign Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Dsc2 A G 18: 20,167,758 (GRCm39) F111L probably damaging Het
Dsc2 T A 18: 20,178,622 (GRCm39) I261F probably benign Het
Ece1 T C 4: 137,678,819 (GRCm39) V509A probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Grik3 A G 4: 125,564,521 (GRCm39) N501S probably benign Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Lamc3 A G 2: 31,830,763 (GRCm39) D1500G probably damaging Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or10a3m T C 7: 108,313,148 (GRCm39) V184A possibly damaging Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Umod T C 7: 119,064,720 (GRCm39) N592D probably benign Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9,186,070 (GRCm39) missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9,170,056 (GRCm39) missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9,171,853 (GRCm39) missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9,180,381 (GRCm39) missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9,186,098 (GRCm39) missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9,190,474 (GRCm39) missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9,174,435 (GRCm39) intron probably benign
R0149:Dmtf1 UTSW 5 9,182,571 (GRCm39) missense probably damaging 1.00
R0466:Dmtf1 UTSW 5 9,182,454 (GRCm39) critical splice donor site probably null
R0825:Dmtf1 UTSW 5 9,180,388 (GRCm39) missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9,177,987 (GRCm39) missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9,177,987 (GRCm39) missense possibly damaging 0.51
R0974:Dmtf1 UTSW 5 9,177,987 (GRCm39) missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9,186,109 (GRCm39) missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9,190,383 (GRCm39) splice site probably null
R1478:Dmtf1 UTSW 5 9,171,404 (GRCm39) missense possibly damaging 0.93
R1861:Dmtf1 UTSW 5 9,170,347 (GRCm39) splice site probably null
R1898:Dmtf1 UTSW 5 9,178,091 (GRCm39) missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9,198,989 (GRCm39) missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9,198,989 (GRCm39) missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9,179,323 (GRCm39) missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9,179,316 (GRCm39) missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9,182,454 (GRCm39) intron probably benign
R4467:Dmtf1 UTSW 5 9,186,085 (GRCm39) missense probably damaging 1.00
R4490:Dmtf1 UTSW 5 9,190,379 (GRCm39) intron probably benign
R4491:Dmtf1 UTSW 5 9,190,379 (GRCm39) intron probably benign
R5007:Dmtf1 UTSW 5 9,172,439 (GRCm39) unclassified probably benign
R5173:Dmtf1 UTSW 5 9,190,356 (GRCm39) intron probably benign
R5184:Dmtf1 UTSW 5 9,176,641 (GRCm39) missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9,174,515 (GRCm39) missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9,172,415 (GRCm39) unclassified probably benign
R5977:Dmtf1 UTSW 5 9,190,451 (GRCm39) missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9,176,656 (GRCm39) missense probably benign
R6887:Dmtf1 UTSW 5 9,187,149 (GRCm39) missense probably damaging 1.00
R6921:Dmtf1 UTSW 5 9,180,654 (GRCm39) intron probably benign
R7242:Dmtf1 UTSW 5 9,199,016 (GRCm39) missense possibly damaging 0.90
R7706:Dmtf1 UTSW 5 9,174,489 (GRCm39) missense possibly damaging 0.86
R7721:Dmtf1 UTSW 5 9,176,564 (GRCm39) missense probably damaging 1.00
R7739:Dmtf1 UTSW 5 9,190,453 (GRCm39) missense probably damaging 1.00
R7742:Dmtf1 UTSW 5 9,172,457 (GRCm39) unclassified probably benign
R7859:Dmtf1 UTSW 5 9,178,044 (GRCm39) missense probably damaging 1.00
R7883:Dmtf1 UTSW 5 9,190,397 (GRCm39) missense probably benign 0.35
R7975:Dmtf1 UTSW 5 9,179,169 (GRCm39) missense probably damaging 1.00
R8269:Dmtf1 UTSW 5 9,182,500 (GRCm39) nonsense probably null
R8479:Dmtf1 UTSW 5 9,170,428 (GRCm39) missense probably damaging 0.97
R8782:Dmtf1 UTSW 5 9,179,168 (GRCm39) missense probably damaging 1.00
R9296:Dmtf1 UTSW 5 9,190,467 (GRCm39) missense probably benign 0.01
R9359:Dmtf1 UTSW 5 9,171,927 (GRCm39) missense possibly damaging 0.73
R9372:Dmtf1 UTSW 5 9,190,399 (GRCm39) missense possibly damaging 0.86
R9403:Dmtf1 UTSW 5 9,171,927 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCTCCAGACACAGATGAAGGTACATCC -3'
(R):5'- AGTGTCACCCAACATAATGTCTTGTCC -3'

Sequencing Primer
(F):5'- CAGATGAAGGTACATCCATTACTTCC -3'
(R):5'- CCATGAAAGGAGTTTCCTACCTGG -3'
Posted On 2014-04-13