Mutagenetix > Incidental Mutations

Incidental Mutation 'R1515:Fzd10'

168216

Institutional Source

Beutler Lab

Gene Symbol

Fzd10

Ensembl Gene

ENSMUSG00000081683

Gene Name

frizzled class receptor 10

Synonyms

Fz-10

MMRRC Submission

039562-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1515 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128600844-128604093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128602559 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 448 (F448I)

Ref Sequence

ENSEMBL: ENSMUSP00000114114 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117102]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000091324

Predicted Effect

probably damaging
Transcript: ENSMUST00000117102
AA Change: F448I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: F448I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FRI	34	153	7.83e-68	SMART
Frizzled	218	542	2.62e-207	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126472

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154305

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199981

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akt2	A	G	7: 27,637,158	T401A	probably damaging	Het
Arhgap32	G	T	9: 32,116,202	V23L	probably benign	Het
Atmin	T	A	8: 116,954,840	C193S	possibly damaging	Het
Atp13a5	C	T	16: 29,333,974	V225I	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC024139	A	G	15: 76,124,326	V350A	possibly damaging	Het
Birc6	G	T	17: 74,528,636	E29*	probably null	Het
Bnc2	T	C	4: 84,414,326	N104S	probably null	Het
C030048H21Rik	T	C	2: 26,257,503		probably null	Het
Cd320	G	T	17: 33,847,639	C117F	probably damaging	Het
Cdkal1	A	G	13: 29,326,150	S542P	probably damaging	Het
Crocc	T	C	4: 141,019,737	T1587A	probably benign	Het
Defb41	T	C	1: 18,260,593		probably null	Het
Dmtf1	A	G	5: 9,140,384		probably null	Het
Dnhd1	A	G	7: 105,704,148	N2836S	probably benign	Het
Dpp8	G	A	9: 65,078,748	S840N	probably benign	Het
Dsc2	A	G	18: 20,034,701	F111L	probably damaging	Het
Dsc2	T	A	18: 20,045,565	I261F	probably benign	Het
Ece1	T	C	4: 137,951,508	V509A	probably benign	Het
Ecm2	T	C	13: 49,518,332	M103T	possibly damaging	Het
Emsy	T	C	7: 98,590,856	H1064R	probably damaging	Het
Engase	T	C	11: 118,487,140	V252A	possibly damaging	Het
F13b	A	G	1: 139,510,965	Y369C	probably damaging	Het
Flii	T	C	11: 60,721,606		probably null	Het
Gpr35	T	G	1: 92,983,048	F161V	probably damaging	Het
Gprin2	T	C	14: 34,195,273	D180G	possibly damaging	Het
Grik3	A	G	4: 125,670,728	N501S	probably benign	Het
Hells	A	G	19: 38,967,765	K802E	probably damaging	Het
Il1r1	T	A	1: 40,293,349	C96*	probably null	Het
Kcnk16	T	A	14: 20,265,277	I73F	probably damaging	Het
Kcnq5	A	G	1: 21,402,681	S652P	probably benign	Het
Lamc3	A	G	2: 31,940,751	D1500G	probably damaging	Het
Macf1	A	G	4: 123,378,480	F6468L	probably damaging	Het
Mgrn1	T	A	16: 4,915,780	F198I	probably benign	Het
Mmp3	A	G	9: 7,451,232	T323A	probably benign	Het
N4bp2	A	G	5: 65,790,498	Y157C	probably benign	Het
Nfkbid	C	A	7: 30,425,356	H190Q	probably benign	Het
Olfr1474	T	C	19: 13,471,680	S237P	probably damaging	Het
Olfr512	T	C	7: 108,713,941	V184A	possibly damaging	Het
Olfr790	T	C	10: 129,501,591	S236P	probably damaging	Het
Osgin2	C	T	4: 15,998,380	G414D	probably benign	Het
Pkd1	G	A	17: 24,594,853	R4097H	probably benign	Het
Pnkd	T	A	1: 74,349,809	L213Q	probably null	Het
Ppfibp1	A	G	6: 147,027,432	H850R	probably benign	Het
Ppp6r1	T	C	7: 4,643,258	D148G	probably damaging	Het
Ptprt	A	T	2: 162,238,034	S282T	probably damaging	Het
Sgsm3	T	C	15: 81,010,256	V536A	probably benign	Het
Slc22a23	T	A	13: 34,203,964	Q383L	probably benign	Het
Snx29	T	C	16: 11,399,837		probably null	Het
Tmem229b-ps	T	A	10: 53,475,446		noncoding transcript	Het
Tmod4	A	T	3: 95,128,679	Y317F	possibly damaging	Het
Trim13	T	C	14: 61,605,659	M375T	probably benign	Het
Txndc11	A	G	16: 11,075,062	S935P	probably damaging	Het
Umod	T	C	7: 119,465,497	N592D	probably benign	Het
Vmn2r118	A	G	17: 55,610,643	Y290H	probably benign	Het
Vps26b	A	G	9: 27,012,745	M234T	probably damaging	Het
Zbtb48	A	G	4: 152,020,201		probably null	Het
Zfc3h1	T	A	10: 115,416,742	F1320Y	probably benign	Het
Zfp784	A	T	7: 5,036,040		probably benign	Het

Other mutations in Fzd10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Fzd10	APN	5	128601528	missense	probably damaging	1.00
IGL02354:Fzd10	APN	5	128601868	missense	possibly damaging	0.89
IGL02361:Fzd10	APN	5	128601868	missense	possibly damaging	0.89
IGL03088:Fzd10	APN	5	128602605	missense	possibly damaging	0.81
R0530:Fzd10	UTSW	5	128602013	missense	probably damaging	1.00
R0645:Fzd10	UTSW	5	128602598	missense	possibly damaging	0.94
R3930:Fzd10	UTSW	5	128602412	missense	probably damaging	1.00
R4467:Fzd10	UTSW	5	128601276	missense	probably benign	0.01
R4976:Fzd10	UTSW	5	128602114	nonsense	probably null
R5156:Fzd10	UTSW	5	128601302	missense	possibly damaging	0.68
R5202:Fzd10	UTSW	5	128602116	missense	possibly damaging	0.78
R5874:Fzd10	UTSW	5	128601300	missense	probably benign	0.41
R6238:Fzd10	UTSW	5	128602931	missense	probably damaging	0.99
R6921:Fzd10	UTSW	5	128601582	missense	probably damaging	0.99
R7684:Fzd10	UTSW	5	128601416
Z1088:Fzd10	UTSW	5	128601246	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CATCCCGGCTGTGAAGACTATCTTG -3'
(R):5'- ACCAGCAGCATGGACACTTTGAC -3'

Sequencing Primer
(F):5'- AAGACTATCTTGATCTTGGTGATGC -3'
(R):5'- TGGACACTTTGACCATGAAGAC -3'

Posted On

2014-04-13