Incidental Mutation 'R1515:Dnhd1'
ID 168223
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Name dynein heavy chain domain 1
Synonyms 8030491N06Rik
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 105300034-105371006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105353355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 2836 (N2836S)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000145988
AA Change: N2836S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: N2836S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dmtf1 A G 5: 9,190,384 (GRCm39) probably null Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Dsc2 A G 18: 20,167,758 (GRCm39) F111L probably damaging Het
Dsc2 T A 18: 20,178,622 (GRCm39) I261F probably benign Het
Ece1 T C 4: 137,678,819 (GRCm39) V509A probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Grik3 A G 4: 125,564,521 (GRCm39) N501S probably benign Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Lamc3 A G 2: 31,830,763 (GRCm39) D1500G probably damaging Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or10a3m T C 7: 108,313,148 (GRCm39) V184A possibly damaging Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Umod T C 7: 119,064,720 (GRCm39) N592D probably benign Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105,327,202 (GRCm39) missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105,306,418 (GRCm39) missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105,341,882 (GRCm39) missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105,370,895 (GRCm39) missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105,363,116 (GRCm39) missense probably benign
IGL01714:Dnhd1 APN 7 105,370,149 (GRCm39) missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105,362,961 (GRCm39) missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105,301,237 (GRCm39) missense probably benign
IGL01999:Dnhd1 APN 7 105,370,422 (GRCm39) missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105,327,516 (GRCm39) missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105,370,009 (GRCm39) missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105,370,951 (GRCm39) missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105,370,688 (GRCm39) missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105,369,948 (GRCm39) missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105,369,089 (GRCm39) missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105,363,682 (GRCm39) missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105,362,940 (GRCm39) missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105,304,930 (GRCm39) missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105,370,131 (GRCm39) missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105,369,321 (GRCm39) missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105,343,602 (GRCm39) missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105,363,252 (GRCm39) missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105,344,958 (GRCm39) missense probably benign
R0669:Dnhd1 UTSW 7 105,342,911 (GRCm39) missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105,301,113 (GRCm39) missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105,358,378 (GRCm39) missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105,362,238 (GRCm39) missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105,346,106 (GRCm39) missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105,343,360 (GRCm39) missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105,369,331 (GRCm39) missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105,370,480 (GRCm39) critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105,317,670 (GRCm39) missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105,342,867 (GRCm39) missense possibly damaging 0.67
R1615:Dnhd1 UTSW 7 105,362,913 (GRCm39) missense possibly damaging 0.74
R1615:Dnhd1 UTSW 7 105,352,413 (GRCm39) missense probably benign 0.00
R1656:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105,343,035 (GRCm39) missense probably benign
R1723:Dnhd1 UTSW 7 105,364,127 (GRCm39) missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105,343,179 (GRCm39) missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105,304,974 (GRCm39) missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105,353,412 (GRCm39) missense probably benign
R1920:Dnhd1 UTSW 7 105,362,614 (GRCm39) missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105,323,061 (GRCm39) missense probably damaging 0.96
R1925:Dnhd1 UTSW 7 105,301,459 (GRCm39) missense probably damaging 1.00
R1934:Dnhd1 UTSW 7 105,357,789 (GRCm39) missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105,354,128 (GRCm39) missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105,327,178 (GRCm39) missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105,342,928 (GRCm39) missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105,352,979 (GRCm39) missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105,354,606 (GRCm39) missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105,323,628 (GRCm39) missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105,359,297 (GRCm39) missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105,352,674 (GRCm39) missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105,342,871 (GRCm39) missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105,369,438 (GRCm39) missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105,361,766 (GRCm39) missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105,369,436 (GRCm39) missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105,345,772 (GRCm39) critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3405:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3439:Dnhd1 UTSW 7 105,343,992 (GRCm39) missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105,362,329 (GRCm39) missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105,364,045 (GRCm39) missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105,358,795 (GRCm39) missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105,362,205 (GRCm39) missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105,345,935 (GRCm39) nonsense probably null
R4565:Dnhd1 UTSW 7 105,301,163 (GRCm39) missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105,306,373 (GRCm39) splice site probably null
R4584:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105,363,237 (GRCm39) missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105,364,653 (GRCm39) missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105,352,851 (GRCm39) missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105,304,948 (GRCm39) missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105,370,324 (GRCm39) missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105,353,171 (GRCm39) missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105,364,015 (GRCm39) missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105,306,164 (GRCm39) missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105,362,840 (GRCm39) missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105,362,283 (GRCm39) missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105,342,904 (GRCm39) missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105,362,647 (GRCm39) missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105,363,759 (GRCm39) missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105,345,667 (GRCm39) missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105,353,130 (GRCm39) missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105,334,968 (GRCm39) missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5258:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5273:Dnhd1 UTSW 7 105,363,689 (GRCm39) missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105,363,644 (GRCm39) missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105,362,891 (GRCm39) missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105,363,363 (GRCm39) missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105,364,028 (GRCm39) missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105,323,395 (GRCm39) missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105,354,217 (GRCm39) missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105,304,981 (GRCm39) missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105,369,102 (GRCm39) missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105,369,388 (GRCm39) missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105,344,955 (GRCm39) missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105,369,711 (GRCm39) missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105,363,194 (GRCm39) missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105,358,647 (GRCm39) missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105,353,255 (GRCm39) missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105,301,216 (GRCm39) missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105,342,577 (GRCm39) missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105,343,273 (GRCm39) missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105,327,093 (GRCm39) missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105,353,006 (GRCm39) missense probably benign
R6663:Dnhd1 UTSW 7 105,334,899 (GRCm39) splice site probably null
R6730:Dnhd1 UTSW 7 105,353,082 (GRCm39) missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105,369,844 (GRCm39) missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105,352,580 (GRCm39) missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105,369,137 (GRCm39) missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105,352,935 (GRCm39) missense probably benign
R6860:Dnhd1 UTSW 7 105,327,473 (GRCm39) missense probably benign
R6898:Dnhd1 UTSW 7 105,336,584 (GRCm39) missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105,364,770 (GRCm39) missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105,362,895 (GRCm39) missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105,353,792 (GRCm39) missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105,363,417 (GRCm39) missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105,370,005 (GRCm39) missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105,344,161 (GRCm39) missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105,364,468 (GRCm39) missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105,357,739 (GRCm39) missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105,363,192 (GRCm39) missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105,342,973 (GRCm39) missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105,359,234 (GRCm39) missense probably benign 0.03
R7178:Dnhd1 UTSW 7 105,344,200 (GRCm39) missense probably damaging 0.98
R7326:Dnhd1 UTSW 7 105,370,137 (GRCm39) missense probably damaging 0.96
R7345:Dnhd1 UTSW 7 105,353,174 (GRCm39) missense probably benign 0.17
R7349:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R7397:Dnhd1 UTSW 7 105,354,504 (GRCm39) missense possibly damaging 0.87
R7520:Dnhd1 UTSW 7 105,345,255 (GRCm39) missense probably benign 0.07
R7536:Dnhd1 UTSW 7 105,358,768 (GRCm39) missense probably damaging 1.00
R7539:Dnhd1 UTSW 7 105,370,119 (GRCm39) missense probably damaging 1.00
R7541:Dnhd1 UTSW 7 105,327,516 (GRCm39) missense probably damaging 1.00
R7619:Dnhd1 UTSW 7 105,323,475 (GRCm39) missense probably benign 0.01
R7676:Dnhd1 UTSW 7 105,333,294 (GRCm39) missense probably benign 0.09
R7689:Dnhd1 UTSW 7 105,363,170 (GRCm39) missense probably benign 0.07
R7712:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R7729:Dnhd1 UTSW 7 105,354,472 (GRCm39) missense probably damaging 1.00
R7767:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R7768:Dnhd1 UTSW 7 105,370,302 (GRCm39) missense possibly damaging 0.87
R7779:Dnhd1 UTSW 7 105,327,122 (GRCm39) missense probably benign 0.01
R7879:Dnhd1 UTSW 7 105,352,646 (GRCm39) missense probably benign 0.09
R7922:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 1.00
R7951:Dnhd1 UTSW 7 105,327,211 (GRCm39) missense probably damaging 1.00
R8259:Dnhd1 UTSW 7 105,343,995 (GRCm39) missense probably benign 0.38
R8350:Dnhd1 UTSW 7 105,327,231 (GRCm39) missense probably damaging 0.99
R8380:Dnhd1 UTSW 7 105,327,073 (GRCm39) missense probably benign 0.31
R8392:Dnhd1 UTSW 7 105,352,550 (GRCm39) missense possibly damaging 0.84
R8478:Dnhd1 UTSW 7 105,332,001 (GRCm39) missense probably benign 0.00
R8708:Dnhd1 UTSW 7 105,343,487 (GRCm39) nonsense probably null
R8767:Dnhd1 UTSW 7 105,301,330 (GRCm39) missense probably damaging 1.00
R8825:Dnhd1 UTSW 7 105,343,174 (GRCm39) missense possibly damaging 0.95
R8849:Dnhd1 UTSW 7 105,370,723 (GRCm39) missense probably benign 0.00
R8903:Dnhd1 UTSW 7 105,362,855 (GRCm39) nonsense probably null
R8910:Dnhd1 UTSW 7 105,332,904 (GRCm39) missense possibly damaging 0.92
R8940:Dnhd1 UTSW 7 105,363,854 (GRCm39) intron probably benign
R8954:Dnhd1 UTSW 7 105,343,986 (GRCm39) missense probably benign 0.35
R8956:Dnhd1 UTSW 7 105,341,852 (GRCm39) missense probably damaging 0.99
R8971:Dnhd1 UTSW 7 105,358,528 (GRCm39) nonsense probably null
R8996:Dnhd1 UTSW 7 105,323,242 (GRCm39) missense probably damaging 1.00
R9051:Dnhd1 UTSW 7 105,341,933 (GRCm39) missense possibly damaging 0.54
R9058:Dnhd1 UTSW 7 105,333,270 (GRCm39) missense probably benign 0.01
R9109:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9284:Dnhd1 UTSW 7 105,301,091 (GRCm39) missense probably damaging 1.00
R9295:Dnhd1 UTSW 7 105,363,348 (GRCm39) missense probably benign
R9298:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9299:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9308:Dnhd1 UTSW 7 105,353,484 (GRCm39) missense probably damaging 1.00
R9337:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9385:Dnhd1 UTSW 7 105,361,972 (GRCm39) missense probably damaging 1.00
R9463:Dnhd1 UTSW 7 105,344,223 (GRCm39) missense probably benign
R9463:Dnhd1 UTSW 7 105,306,454 (GRCm39) missense probably benign 0.00
R9476:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9489:Dnhd1 UTSW 7 105,300,804 (GRCm39) missense probably benign
R9500:Dnhd1 UTSW 7 105,353,709 (GRCm39) missense probably benign
R9510:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9513:Dnhd1 UTSW 7 105,354,179 (GRCm39) missense probably damaging 1.00
R9537:Dnhd1 UTSW 7 105,344,740 (GRCm39) missense probably damaging 0.99
R9567:Dnhd1 UTSW 7 105,353,473 (GRCm39) missense probably benign 0.03
R9622:Dnhd1 UTSW 7 105,353,342 (GRCm39) missense probably benign
R9623:Dnhd1 UTSW 7 105,344,134 (GRCm39) missense probably damaging 1.00
R9623:Dnhd1 UTSW 7 105,335,773 (GRCm39) missense probably damaging 1.00
R9674:Dnhd1 UTSW 7 105,363,429 (GRCm39) missense probably damaging 1.00
R9756:Dnhd1 UTSW 7 105,353,135 (GRCm39) missense probably benign 0.19
R9777:Dnhd1 UTSW 7 105,369,456 (GRCm39) missense probably benign 0.14
R9778:Dnhd1 UTSW 7 105,353,240 (GRCm39) missense probably benign
R9781:Dnhd1 UTSW 7 105,352,917 (GRCm39) missense probably benign 0.31
R9796:Dnhd1 UTSW 7 105,342,537 (GRCm39) missense probably damaging 1.00
Z1088:Dnhd1 UTSW 7 105,361,934 (GRCm39) missense probably benign 0.00
Z1176:Dnhd1 UTSW 7 105,352,243 (GRCm39) critical splice acceptor site probably null
Z1176:Dnhd1 UTSW 7 105,327,506 (GRCm39) missense probably benign
Z1176:Dnhd1 UTSW 7 105,317,754 (GRCm39) missense probably damaging 0.98
Z1176:Dnhd1 UTSW 7 105,352,787 (GRCm39) frame shift probably null
Z1177:Dnhd1 UTSW 7 105,332,048 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTGGGAGACCTTAAGCAACAGTGAC -3'
(R):5'- TGAGCCTGACAAATGCTAGAAGCC -3'

Sequencing Primer
(F):5'- TTCCTCAGTGAGAACAGTCTAGC -3'
(R):5'- TGTATAGCGCCCAGTACCC -3'
Posted On 2014-04-13