Incidental Mutation 'R1515:Olfr512'
ID168224
Institutional Source Beutler Lab
Gene Symbol Olfr512
Ensembl Gene ENSMUSG00000056946
Gene Nameolfactory receptor 512
SynonymsMOR268-3, GA_x6K02T2PBJ9-11043421-11044365
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108713320-108714375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108713941 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 184 (V184A)
Ref Sequence ENSEMBL: ENSMUSP00000147972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074730] [ENSMUST00000209620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074730
AA Change: V196A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074291
Gene: ENSMUSG00000056946
AA Change: V196A

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 7.8e-62 PFAM
Pfam:7TM_GPCR_Srsx 47 317 2.5e-6 PFAM
Pfam:7tm_1 53 302 2.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209620
AA Change: V184A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Olfr512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Olfr512 APN 7 108713882 missense probably benign 0.02
IGL01912:Olfr512 APN 7 108714258 missense possibly damaging 0.60
IGL02182:Olfr512 APN 7 108713868 missense probably benign 0.02
IGL02409:Olfr512 APN 7 108714159 missense probably benign 0.00
IGL02554:Olfr512 APN 7 108713742 missense possibly damaging 0.94
IGL03210:Olfr512 APN 7 108713568 missense probably damaging 1.00
IGL03373:Olfr512 APN 7 108714132 missense probably damaging 1.00
IGL03400:Olfr512 APN 7 108713526 missense probably benign 0.28
R0092:Olfr512 UTSW 7 108713824 missense probably benign
R0741:Olfr512 UTSW 7 108713604 missense probably benign 0.00
R1982:Olfr512 UTSW 7 108713695 missense probably damaging 1.00
R2176:Olfr512 UTSW 7 108714132 missense probably damaging 1.00
R3967:Olfr512 UTSW 7 108713853 missense probably benign
R4009:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4010:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4011:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R5095:Olfr512 UTSW 7 108713812 missense probably damaging 1.00
R5271:Olfr512 UTSW 7 108714217 missense probably damaging 1.00
R5864:Olfr512 UTSW 7 108713464 missense probably benign
R5926:Olfr512 UTSW 7 108713587 missense probably damaging 1.00
R6295:Olfr512 UTSW 7 108713638 missense probably damaging 0.98
R6528:Olfr512 UTSW 7 108713431 missense probably damaging 1.00
R6624:Olfr512 UTSW 7 108713536 missense possibly damaging 0.50
X0023:Olfr512 UTSW 7 108714010 missense possibly damaging 0.79
Z1088:Olfr512 UTSW 7 108713538 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTCTGTTTCAGCACAGTTATCACAC -3'
(R):5'- GACATCAGTTTCTTGGTATCCGGTGAG -3'

Sequencing Primer
(F):5'- ACCTAAAATGCTTGTGGTCCTG -3'
(R):5'- TATACTGGCTGTGCCATAGAAG -3'
Posted On2014-04-13