Incidental Mutation 'R1515:Or10a3m'
ID 168224
Institutional Source Beutler Lab
Gene Symbol Or10a3m
Ensembl Gene ENSMUSG00000056946
Gene Name olfactory receptor family 10 subfamily A member 3M
Synonyms Olfr512, MOR268-3, GA_x6K02T2PBJ9-11043421-11044365
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 108312562-108313542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108313148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 184 (V184A)
Ref Sequence ENSEMBL: ENSMUSP00000147972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074730] [ENSMUST00000209620]
AlphaFold Q8VFZ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000074730
AA Change: V196A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074291
Gene: ENSMUSG00000056946
AA Change: V196A

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 7.8e-62 PFAM
Pfam:7TM_GPCR_Srsx 47 317 2.5e-6 PFAM
Pfam:7tm_1 53 302 2.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209620
AA Change: V184A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dmtf1 A G 5: 9,190,384 (GRCm39) probably null Het
Dnhd1 A G 7: 105,353,355 (GRCm39) N2836S probably benign Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Dsc2 A G 18: 20,167,758 (GRCm39) F111L probably damaging Het
Dsc2 T A 18: 20,178,622 (GRCm39) I261F probably benign Het
Ece1 T C 4: 137,678,819 (GRCm39) V509A probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Grik3 A G 4: 125,564,521 (GRCm39) N501S probably benign Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Lamc3 A G 2: 31,830,763 (GRCm39) D1500G probably damaging Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Umod T C 7: 119,064,720 (GRCm39) N592D probably benign Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Or10a3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Or10a3m APN 7 108,313,089 (GRCm39) missense probably benign 0.02
IGL01912:Or10a3m APN 7 108,313,465 (GRCm39) missense possibly damaging 0.60
IGL02182:Or10a3m APN 7 108,313,075 (GRCm39) missense probably benign 0.02
IGL02409:Or10a3m APN 7 108,313,366 (GRCm39) missense probably benign 0.00
IGL02554:Or10a3m APN 7 108,312,949 (GRCm39) missense possibly damaging 0.94
IGL03210:Or10a3m APN 7 108,312,775 (GRCm39) missense probably damaging 1.00
IGL03373:Or10a3m APN 7 108,313,339 (GRCm39) missense probably damaging 1.00
IGL03400:Or10a3m APN 7 108,312,733 (GRCm39) missense probably benign 0.28
R0092:Or10a3m UTSW 7 108,313,031 (GRCm39) missense probably benign
R0741:Or10a3m UTSW 7 108,312,811 (GRCm39) missense probably benign 0.00
R1982:Or10a3m UTSW 7 108,312,902 (GRCm39) missense probably damaging 1.00
R2176:Or10a3m UTSW 7 108,313,339 (GRCm39) missense probably damaging 1.00
R3967:Or10a3m UTSW 7 108,313,060 (GRCm39) missense probably benign
R4009:Or10a3m UTSW 7 108,313,366 (GRCm39) missense probably benign 0.00
R4010:Or10a3m UTSW 7 108,313,366 (GRCm39) missense probably benign 0.00
R4011:Or10a3m UTSW 7 108,313,366 (GRCm39) missense probably benign 0.00
R5095:Or10a3m UTSW 7 108,313,019 (GRCm39) missense probably damaging 1.00
R5271:Or10a3m UTSW 7 108,313,424 (GRCm39) missense probably damaging 1.00
R5864:Or10a3m UTSW 7 108,312,671 (GRCm39) missense probably benign
R5926:Or10a3m UTSW 7 108,312,794 (GRCm39) missense probably damaging 1.00
R6295:Or10a3m UTSW 7 108,312,845 (GRCm39) missense probably damaging 0.98
R6528:Or10a3m UTSW 7 108,312,638 (GRCm39) missense probably damaging 1.00
R6624:Or10a3m UTSW 7 108,312,743 (GRCm39) missense possibly damaging 0.50
R8029:Or10a3m UTSW 7 108,313,037 (GRCm39) missense possibly damaging 0.70
R8443:Or10a3m UTSW 7 108,313,418 (GRCm39) missense possibly damaging 0.79
R8737:Or10a3m UTSW 7 108,312,964 (GRCm39) missense probably damaging 1.00
R9415:Or10a3m UTSW 7 108,313,042 (GRCm39) missense probably damaging 1.00
R9622:Or10a3m UTSW 7 108,312,677 (GRCm39) missense probably benign 0.30
X0023:Or10a3m UTSW 7 108,313,217 (GRCm39) missense possibly damaging 0.79
Z1088:Or10a3m UTSW 7 108,312,745 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTCTGTTTCAGCACAGTTATCACAC -3'
(R):5'- GACATCAGTTTCTTGGTATCCGGTGAG -3'

Sequencing Primer
(F):5'- ACCTAAAATGCTTGTGGTCCTG -3'
(R):5'- TATACTGGCTGTGCCATAGAAG -3'
Posted On 2014-04-13