Incidental Mutation 'R1515:Umod'
ID 168225
Institutional Source Beutler Lab
Gene Symbol Umod
Ensembl Gene ENSMUSG00000030963
Gene Name uromodulin
Synonyms Tamm-Horsfall glycoprotein, uromucoid, Urehd1, urehr4
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119061931-119078485 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119064720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 592 (N592D)
Ref Sequence ENSEMBL: ENSMUSP00000146652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000209095]
AlphaFold Q91X17
Predicted Effect probably benign
Transcript: ENSMUST00000033263
AA Change: N592D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: N592D

DomainStartEndE-ValueType
EGF 31 64 4.03e-1 SMART
EGF_CA 65 106 3.81e-11 SMART
EGF_CA 107 155 4.81e-8 SMART
Blast:ZP 256 325 6e-30 BLAST
ZP 335 586 2.19e-70 SMART
low complexity region 619 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208401
Predicted Effect probably benign
Transcript: ENSMUST00000209095
AA Change: N592D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dmtf1 A G 5: 9,190,384 (GRCm39) probably null Het
Dnhd1 A G 7: 105,353,355 (GRCm39) N2836S probably benign Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Dsc2 A G 18: 20,167,758 (GRCm39) F111L probably damaging Het
Dsc2 T A 18: 20,178,622 (GRCm39) I261F probably benign Het
Ece1 T C 4: 137,678,819 (GRCm39) V509A probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Grik3 A G 4: 125,564,521 (GRCm39) N501S probably benign Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Lamc3 A G 2: 31,830,763 (GRCm39) D1500G probably damaging Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or10a3m T C 7: 108,313,148 (GRCm39) V184A possibly damaging Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Umod
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Umod APN 7 119,076,442 (GRCm39) missense possibly damaging 0.93
IGL02527:Umod APN 7 119,068,690 (GRCm39) missense probably damaging 1.00
R0265:Umod UTSW 7 119,065,296 (GRCm39) missense probably benign 0.00
R1073:Umod UTSW 7 119,063,964 (GRCm39) missense possibly damaging 0.56
R1117:Umod UTSW 7 119,076,529 (GRCm39) missense possibly damaging 0.71
R1774:Umod UTSW 7 119,076,574 (GRCm39) missense possibly damaging 0.82
R1803:Umod UTSW 7 119,063,947 (GRCm39) missense probably damaging 0.96
R1864:Umod UTSW 7 119,062,478 (GRCm39) missense probably damaging 0.99
R1942:Umod UTSW 7 119,076,155 (GRCm39) missense probably damaging 1.00
R2060:Umod UTSW 7 119,075,938 (GRCm39) missense probably damaging 0.97
R2354:Umod UTSW 7 119,065,416 (GRCm39) missense probably damaging 1.00
R3015:Umod UTSW 7 119,071,763 (GRCm39) missense probably damaging 1.00
R3030:Umod UTSW 7 119,076,062 (GRCm39) missense probably benign 0.02
R4016:Umod UTSW 7 119,075,913 (GRCm39) missense possibly damaging 0.56
R4406:Umod UTSW 7 119,065,287 (GRCm39) missense probably damaging 1.00
R4446:Umod UTSW 7 119,065,279 (GRCm39) splice site probably null
R5062:Umod UTSW 7 119,071,644 (GRCm39) nonsense probably null
R5358:Umod UTSW 7 119,071,577 (GRCm39) missense probably damaging 1.00
R5935:Umod UTSW 7 119,070,650 (GRCm39) missense probably damaging 1.00
R6045:Umod UTSW 7 119,076,046 (GRCm39) missense probably benign
R6239:Umod UTSW 7 119,076,520 (GRCm39) missense probably damaging 1.00
R7111:Umod UTSW 7 119,076,369 (GRCm39) nonsense probably null
R7168:Umod UTSW 7 119,077,549 (GRCm39) splice site probably benign
R7265:Umod UTSW 7 119,065,296 (GRCm39) missense probably benign 0.00
R7273:Umod UTSW 7 119,076,250 (GRCm39) missense probably benign 0.16
R8749:Umod UTSW 7 119,070,639 (GRCm39) missense probably benign 0.00
R8786:Umod UTSW 7 119,076,581 (GRCm39) missense possibly damaging 0.76
R8939:Umod UTSW 7 119,068,700 (GRCm39) missense probably damaging 1.00
R9320:Umod UTSW 7 119,065,355 (GRCm39) missense probably damaging 1.00
R9689:Umod UTSW 7 119,076,517 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGCCCCACCTACGAGAGTTTATCC -3'
(R):5'- TGCCCTCAATAAGCTGTCAGGCTG -3'

Sequencing Primer
(F):5'- tgaatgaatgaatCCTCTACAATTGG -3'
(R):5'- ATAAGCTGTCAGGCTGGGATG -3'
Posted On 2014-04-13