Incidental Mutation 'R1515:Dpp8'
ID168231
Institutional Source Beutler Lab
Gene Symbol Dpp8
Ensembl Gene ENSMUSG00000032393
Gene Namedipeptidylpeptidase 8
Synonyms2310004I03Rik, 4932434F09Rik
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65032414-65082651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65078748 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 840 (S840N)
Ref Sequence ENSEMBL: ENSMUSP00000126065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034960] [ENSMUST00000167773] [ENSMUST00000217434]
Predicted Effect probably benign
Transcript: ENSMUST00000034960
AA Change: S840N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034960
Gene: ENSMUSG00000032393
AA Change: S840N

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 1e-100 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 671 860 4.8e-9 PFAM
Pfam:Peptidase_S9 676 885 6.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167773
AA Change: S840N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126065
Gene: ENSMUSG00000032393
AA Change: S840N

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 3.3e-102 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 670 860 6.5e-9 PFAM
Pfam:Peptidase_S9 677 885 8.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217328
Predicted Effect probably benign
Transcript: ENSMUST00000217434
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S9B family, a small family of dipeptidyl peptidases that are able to cleave peptide substrates at a prolyl bond. The encoded protein shares similarity with dipeptidyl peptidase IV in that it is ubiquitously expressed, and hydrolyzes the same substrates. These similarities suggest that, like dipeptidyl peptidase IV, this protein may play a role in T-cell activation and immune function. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Dpp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Dpp8 APN 9 65078008 missense probably damaging 1.00
IGL00576:Dpp8 APN 9 65043829 missense probably benign 0.32
IGL01303:Dpp8 APN 9 65055012 splice site probably benign
IGL01506:Dpp8 APN 9 65063417 splice site probably benign
IGL01544:Dpp8 APN 9 65054988 missense probably benign 0.05
IGL02387:Dpp8 APN 9 65045716 missense probably damaging 1.00
IGL02567:Dpp8 APN 9 65078776 nonsense probably null
IGL02611:Dpp8 APN 9 65055793 missense probably benign 0.15
IGL02723:Dpp8 APN 9 65042267 missense possibly damaging 0.91
IGL02927:Dpp8 APN 9 65060269 missense probably benign 0.09
IGL03116:Dpp8 APN 9 65066467 missense probably damaging 0.96
IGL03135:Dpp8 APN 9 65053040 splice site probably null
IGL03356:Dpp8 APN 9 65045787 missense probably benign 0.00
IGL03050:Dpp8 UTSW 9 65054836 missense probably benign 0.00
R0498:Dpp8 UTSW 9 65045795 splice site probably benign
R0594:Dpp8 UTSW 9 65036998 missense probably damaging 1.00
R0675:Dpp8 UTSW 9 65066502 splice site probably benign
R0699:Dpp8 UTSW 9 65054894 missense probably benign 0.01
R0831:Dpp8 UTSW 9 65078679 missense possibly damaging 0.56
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1512:Dpp8 UTSW 9 65063814 splice site probably benign
R1546:Dpp8 UTSW 9 65063493 missense possibly damaging 0.76
R1556:Dpp8 UTSW 9 65051479 missense probably damaging 1.00
R2027:Dpp8 UTSW 9 65078774 missense probably damaging 1.00
R2104:Dpp8 UTSW 9 65074567 synonymous probably null
R2113:Dpp8 UTSW 9 65063868 missense probably benign 0.00
R2656:Dpp8 UTSW 9 65080804 missense probably damaging 1.00
R4237:Dpp8 UTSW 9 65054923 missense probably benign
R4238:Dpp8 UTSW 9 65054923 missense probably benign
R4239:Dpp8 UTSW 9 65054923 missense probably benign
R4595:Dpp8 UTSW 9 65075803 missense probably damaging 1.00
R4614:Dpp8 UTSW 9 65066396 missense probably benign 0.00
R4946:Dpp8 UTSW 9 65055918 missense probably benign 0.00
R5338:Dpp8 UTSW 9 65063924 nonsense probably null
R5378:Dpp8 UTSW 9 65078014 missense probably damaging 1.00
R5506:Dpp8 UTSW 9 65078109 splice site probably null
R5644:Dpp8 UTSW 9 65045735 nonsense probably null
R5862:Dpp8 UTSW 9 65045722 missense probably benign 0.03
R6437:Dpp8 UTSW 9 65074578 missense probably benign 0.01
R6783:Dpp8 UTSW 9 65063562 missense possibly damaging 0.76
R6863:Dpp8 UTSW 9 65035008 missense probably damaging 0.98
R7192:Dpp8 UTSW 9 65045786 missense possibly damaging 0.70
R7461:Dpp8 UTSW 9 65053120 missense possibly damaging 0.86
R7514:Dpp8 UTSW 9 65078754 missense probably damaging 1.00
R7548:Dpp8 UTSW 9 65037235 missense probably damaging 1.00
R7584:Dpp8 UTSW 9 65078782 missense probably damaging 0.98
R7605:Dpp8 UTSW 9 65054958 missense probably benign 0.33
R7613:Dpp8 UTSW 9 65053120 missense possibly damaging 0.86
R7665:Dpp8 UTSW 9 65078718 missense probably damaging 1.00
R7698:Dpp8 UTSW 9 65042336 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGTTAAAGGACGTGCGGGTCAGC -3'
(R):5'- GAAGACCAGAAGAGGCCACCATTTC -3'

Sequencing Primer
(F):5'- AGCCGTCACGCTCTTCTG -3'
(R):5'- TCAGCTAAAGACTGGAAGTTATGC -3'
Posted On2014-04-13