Mutagenetix > Incidental Mutations

Incidental Mutation 'R1515:Cdkal1'

168237

Institutional Source

Beutler Lab

Gene Symbol

Cdkal1

Ensembl Gene

ENSMUSG00000006191

Gene Name

CDK5 regulatory subunit associated protein 1-like 1

Synonyms

MMRRC Submission

039562-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1515 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29191746-29855674 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29326150 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 542 (S542P)

Ref Sequence

ENSEMBL: ENSMUSP00000006353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006353] [ENSMUST00000140278]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006353
AA Change: S542P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000006353
Gene: ENSMUSG00000006191
AA Change: S542P

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:UPF0004	64	152	5.7e-24	PFAM
Elp3	202	421	1.88e-40	SMART
Pfam:TRAM	430	491	7e-9	PFAM
low complexity region	554	568	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140278

SMART Domains

Protein: ENSMUSP00000122249
Gene: ENSMUSG00000006191

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:UPF0004	64	152	8.7e-24	PFAM
Elp3	202	421	1.88e-40	SMART
Pfam:TRAM	430	491	9.6e-10	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the methylthiotransferase family. The function of this gene is not known. Genome-wide association studies have linked single nucleotide polymorphisms in an intron of this gene with susceptibilty to type 2 diabetes. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired tRNALys modification. Mice homozygous for a gene trap allele exhibit altered glucose homeostasis and lipid accumulation at early stages when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akt2	A	G	7: 27,637,158	T401A	probably damaging	Het
Arhgap32	G	T	9: 32,116,202	V23L	probably benign	Het
Atmin	T	A	8: 116,954,840	C193S	possibly damaging	Het
Atp13a5	C	T	16: 29,333,974	V225I	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC024139	A	G	15: 76,124,326	V350A	possibly damaging	Het
Birc6	G	T	17: 74,528,636	E29*	probably null	Het
Bnc2	T	C	4: 84,414,326	N104S	probably null	Het
C030048H21Rik	T	C	2: 26,257,503		probably null	Het
Cd320	G	T	17: 33,847,639	C117F	probably damaging	Het
Crocc	T	C	4: 141,019,737	T1587A	probably benign	Het
Defb41	T	C	1: 18,260,593		probably null	Het
Dmtf1	A	G	5: 9,140,384		probably null	Het
Dnhd1	A	G	7: 105,704,148	N2836S	probably benign	Het
Dpp8	G	A	9: 65,078,748	S840N	probably benign	Het
Dsc2	A	G	18: 20,034,701	F111L	probably damaging	Het
Dsc2	T	A	18: 20,045,565	I261F	probably benign	Het
Ece1	T	C	4: 137,951,508	V509A	probably benign	Het
Ecm2	T	C	13: 49,518,332	M103T	possibly damaging	Het
Emsy	T	C	7: 98,590,856	H1064R	probably damaging	Het
Engase	T	C	11: 118,487,140	V252A	possibly damaging	Het
F13b	A	G	1: 139,510,965	Y369C	probably damaging	Het
Flii	T	C	11: 60,721,606		probably null	Het
Fzd10	T	A	5: 128,602,559	F448I	probably damaging	Het
Gpr35	T	G	1: 92,983,048	F161V	probably damaging	Het
Gprin2	T	C	14: 34,195,273	D180G	possibly damaging	Het
Grik3	A	G	4: 125,670,728	N501S	probably benign	Het
Hells	A	G	19: 38,967,765	K802E	probably damaging	Het
Il1r1	T	A	1: 40,293,349	C96*	probably null	Het
Kcnk16	T	A	14: 20,265,277	I73F	probably damaging	Het
Kcnq5	A	G	1: 21,402,681	S652P	probably benign	Het
Lamc3	A	G	2: 31,940,751	D1500G	probably damaging	Het
Macf1	A	G	4: 123,378,480	F6468L	probably damaging	Het
Mgrn1	T	A	16: 4,915,780	F198I	probably benign	Het
Mmp3	A	G	9: 7,451,232	T323A	probably benign	Het
N4bp2	A	G	5: 65,790,498	Y157C	probably benign	Het
Nfkbid	C	A	7: 30,425,356	H190Q	probably benign	Het
Olfr1474	T	C	19: 13,471,680	S237P	probably damaging	Het
Olfr512	T	C	7: 108,713,941	V184A	possibly damaging	Het
Olfr790	T	C	10: 129,501,591	S236P	probably damaging	Het
Osgin2	C	T	4: 15,998,380	G414D	probably benign	Het
Pkd1	G	A	17: 24,594,853	R4097H	probably benign	Het
Pnkd	T	A	1: 74,349,809	L213Q	probably null	Het
Ppfibp1	A	G	6: 147,027,432	H850R	probably benign	Het
Ppp6r1	T	C	7: 4,643,258	D148G	probably damaging	Het
Ptprt	A	T	2: 162,238,034	S282T	probably damaging	Het
Sgsm3	T	C	15: 81,010,256	V536A	probably benign	Het
Slc22a23	T	A	13: 34,203,964	Q383L	probably benign	Het
Snx29	T	C	16: 11,399,837		probably null	Het
Tmem229b-ps	T	A	10: 53,475,446		noncoding transcript	Het
Tmod4	A	T	3: 95,128,679	Y317F	possibly damaging	Het
Trim13	T	C	14: 61,605,659	M375T	probably benign	Het
Txndc11	A	G	16: 11,075,062	S935P	probably damaging	Het
Umod	T	C	7: 119,465,497	N592D	probably benign	Het
Vmn2r118	A	G	17: 55,610,643	Y290H	probably benign	Het
Vps26b	A	G	9: 27,012,745	M234T	probably damaging	Het
Zbtb48	A	G	4: 152,020,201		probably null	Het
Zfc3h1	T	A	10: 115,416,742	F1320Y	probably benign	Het
Zfp784	A	T	7: 5,036,040		probably benign	Het

Other mutations in Cdkal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02090:Cdkal1	APN	13	29517510	missense	probably benign	0.01
IGL03111:Cdkal1	APN	13	29354701	missense	possibly damaging	0.52
R0450:Cdkal1	UTSW	13	29691596	splice site	probably null
R0510:Cdkal1	UTSW	13	29691596	splice site	probably null
R0513:Cdkal1	UTSW	13	29625965	intron	probably benign
R0631:Cdkal1	UTSW	13	29354684	nonsense	probably null
R1309:Cdkal1	UTSW	13	29357583	missense	possibly damaging	0.80
R1774:Cdkal1	UTSW	13	29850048	missense	probably damaging	1.00
R1803:Cdkal1	UTSW	13	29517471	missense	probably damaging	1.00
R1815:Cdkal1	UTSW	13	29717791	missense	possibly damaging	0.52
R2134:Cdkal1	UTSW	13	29354677	missense	possibly damaging	0.93
R2219:Cdkal1	UTSW	13	29354758	missense	probably benign	0.01
R2220:Cdkal1	UTSW	13	29354758	missense	probably benign	0.01
R2389:Cdkal1	UTSW	13	29552236	missense	probably damaging	1.00
R2497:Cdkal1	UTSW	13	29474541	missense	unknown
R2964:Cdkal1	UTSW	13	29444035	missense	unknown
R3769:Cdkal1	UTSW	13	29552403	splice site	probably null
R5092:Cdkal1	UTSW	13	29846239	missense	probably damaging	1.00
R5164:Cdkal1	UTSW	13	29625719	missense	probably damaging	1.00
R5333:Cdkal1	UTSW	13	29326152	missense	probably benign	0.01
R5514:Cdkal1	UTSW	13	29777287	missense	probably damaging	1.00
R5630:Cdkal1	UTSW	13	29777215	critical splice donor site	probably null
R5838:Cdkal1	UTSW	13	29691686	missense	probably benign
R6729:Cdkal1	UTSW	13	29474695	missense	probably damaging	1.00
R8352:Cdkal1	UTSW	13	29354680	missense	probably benign	0.13
R8444:Cdkal1	UTSW	13	29326104	missense	probably benign	0.23
R8452:Cdkal1	UTSW	13	29354680	missense	probably benign	0.13
R8825:Cdkal1	UTSW	13	29354794	missense	probably benign	0.22
R8878:Cdkal1	UTSW	13	29474624	missense	probably damaging	1.00
Z1088:Cdkal1	UTSW	13	29777236	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCTCAGTGTGAGGGCATTCAGAAG -3'
(R):5'- TCTGGTCACTCAGACCCCTGTTAG -3'

Sequencing Primer
(F):5'- GTCTAGTTCAGAAGGCAGTCTC -3'
(R):5'- CTTGGGAATCATCCAAACGGAA -3'

Posted On

2014-04-13