Incidental Mutation 'R1515:Cdkal1'
ID168237
Institutional Source Beutler Lab
Gene Symbol Cdkal1
Ensembl Gene ENSMUSG00000006191
Gene NameCDK5 regulatory subunit associated protein 1-like 1
Synonyms
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location29191746-29855674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29326150 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 542 (S542P)
Ref Sequence ENSEMBL: ENSMUSP00000006353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006353] [ENSMUST00000140278]
Predicted Effect probably damaging
Transcript: ENSMUST00000006353
AA Change: S542P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006353
Gene: ENSMUSG00000006191
AA Change: S542P

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:UPF0004 64 152 5.7e-24 PFAM
Elp3 202 421 1.88e-40 SMART
Pfam:TRAM 430 491 7e-9 PFAM
low complexity region 554 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140278
SMART Domains Protein: ENSMUSP00000122249
Gene: ENSMUSG00000006191

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:UPF0004 64 152 8.7e-24 PFAM
Elp3 202 421 1.88e-40 SMART
Pfam:TRAM 430 491 9.6e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the methylthiotransferase family. The function of this gene is not known. Genome-wide association studies have linked single nucleotide polymorphisms in an intron of this gene with susceptibilty to type 2 diabetes. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired tRNALys modification. Mice homozygous for a gene trap allele exhibit altered glucose homeostasis and lipid accumulation at early stages when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Cdkal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Cdkal1 APN 13 29517510 missense probably benign 0.01
IGL03111:Cdkal1 APN 13 29354701 missense possibly damaging 0.52
R0450:Cdkal1 UTSW 13 29691596 splice site probably null
R0510:Cdkal1 UTSW 13 29691596 splice site probably null
R0513:Cdkal1 UTSW 13 29625965 intron probably benign
R0631:Cdkal1 UTSW 13 29354684 nonsense probably null
R1309:Cdkal1 UTSW 13 29357583 missense possibly damaging 0.80
R1774:Cdkal1 UTSW 13 29850048 missense probably damaging 1.00
R1803:Cdkal1 UTSW 13 29517471 missense probably damaging 1.00
R1815:Cdkal1 UTSW 13 29717791 missense possibly damaging 0.52
R2134:Cdkal1 UTSW 13 29354677 missense possibly damaging 0.93
R2219:Cdkal1 UTSW 13 29354758 missense probably benign 0.01
R2220:Cdkal1 UTSW 13 29354758 missense probably benign 0.01
R2389:Cdkal1 UTSW 13 29552236 missense probably damaging 1.00
R2497:Cdkal1 UTSW 13 29474541 missense unknown
R2964:Cdkal1 UTSW 13 29444035 missense unknown
R3769:Cdkal1 UTSW 13 29552403 splice site probably null
R5092:Cdkal1 UTSW 13 29846239 missense probably damaging 1.00
R5164:Cdkal1 UTSW 13 29625719 missense probably damaging 1.00
R5333:Cdkal1 UTSW 13 29326152 missense probably benign 0.01
R5514:Cdkal1 UTSW 13 29777287 missense probably damaging 1.00
R5630:Cdkal1 UTSW 13 29777215 critical splice donor site probably null
R5838:Cdkal1 UTSW 13 29691686 missense probably benign
R6729:Cdkal1 UTSW 13 29474695 missense probably damaging 1.00
R8352:Cdkal1 UTSW 13 29354680 missense probably benign 0.13
R8444:Cdkal1 UTSW 13 29326104 missense probably benign 0.23
R8452:Cdkal1 UTSW 13 29354680 missense probably benign 0.13
R8825:Cdkal1 UTSW 13 29354794 missense probably benign 0.22
R8878:Cdkal1 UTSW 13 29474624 missense probably damaging 1.00
Z1088:Cdkal1 UTSW 13 29777236 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTCAGTGTGAGGGCATTCAGAAG -3'
(R):5'- TCTGGTCACTCAGACCCCTGTTAG -3'

Sequencing Primer
(F):5'- GTCTAGTTCAGAAGGCAGTCTC -3'
(R):5'- CTTGGGAATCATCCAAACGGAA -3'
Posted On2014-04-13