Incidental Mutation 'R1515:Dsc2'
ID 168256
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20178622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 261 (I261F)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably benign
Transcript: ENSMUST00000039247
AA Change: I261F

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: I261F

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075214
AA Change: I261F

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: I261F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dmtf1 A G 5: 9,190,384 (GRCm39) probably null Het
Dnhd1 A G 7: 105,353,355 (GRCm39) N2836S probably benign Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Ece1 T C 4: 137,678,819 (GRCm39) V509A probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Grik3 A G 4: 125,564,521 (GRCm39) N501S probably benign Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Lamc3 A G 2: 31,830,763 (GRCm39) D1500G probably damaging Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or10a3m T C 7: 108,313,148 (GRCm39) V184A possibly damaging Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Umod T C 7: 119,064,720 (GRCm39) N592D probably benign Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20,174,594 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCCAGTGTTTGCTACCGAC -3'
(R):5'- ACTGAGAACCTTTGGGGACCTACC -3'

Sequencing Primer
(F):5'- aagagtcaaaaagagtgtcaatcc -3'
(R):5'- CTGCCTCAAATGGTTAAAGTAAGC -3'
Posted On 2014-04-13