Mutagenetix > Incidental Mutations

Incidental Mutation 'R1515:Dsc2'

168256

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

039562-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1515 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20045565 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 261 (I261F)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

Predicted Effect

probably benign
Transcript: ENSMUST00000039247
AA Change: I261F

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: I261F

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075214
AA Change: I261F

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: I261F

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akt2	A	G	7: 27,637,158	T401A	probably damaging	Het
Arhgap32	G	T	9: 32,116,202	V23L	probably benign	Het
Atmin	T	A	8: 116,954,840	C193S	possibly damaging	Het
Atp13a5	C	T	16: 29,333,974	V225I	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC024139	A	G	15: 76,124,326	V350A	possibly damaging	Het
Birc6	G	T	17: 74,528,636	E29*	probably null	Het
Bnc2	T	C	4: 84,414,326	N104S	probably null	Het
C030048H21Rik	T	C	2: 26,257,503		probably null	Het
Cd320	G	T	17: 33,847,639	C117F	probably damaging	Het
Cdkal1	A	G	13: 29,326,150	S542P	probably damaging	Het
Crocc	T	C	4: 141,019,737	T1587A	probably benign	Het
Defb41	T	C	1: 18,260,593		probably null	Het
Dmtf1	A	G	5: 9,140,384		probably null	Het
Dnhd1	A	G	7: 105,704,148	N2836S	probably benign	Het
Dpp8	G	A	9: 65,078,748	S840N	probably benign	Het
Ece1	T	C	4: 137,951,508	V509A	probably benign	Het
Ecm2	T	C	13: 49,518,332	M103T	possibly damaging	Het
Emsy	T	C	7: 98,590,856	H1064R	probably damaging	Het
Engase	T	C	11: 118,487,140	V252A	possibly damaging	Het
F13b	A	G	1: 139,510,965	Y369C	probably damaging	Het
Flii	T	C	11: 60,721,606		probably null	Het
Fzd10	T	A	5: 128,602,559	F448I	probably damaging	Het
Gpr35	T	G	1: 92,983,048	F161V	probably damaging	Het
Gprin2	T	C	14: 34,195,273	D180G	possibly damaging	Het
Grik3	A	G	4: 125,670,728	N501S	probably benign	Het
Hells	A	G	19: 38,967,765	K802E	probably damaging	Het
Il1r1	T	A	1: 40,293,349	C96*	probably null	Het
Kcnk16	T	A	14: 20,265,277	I73F	probably damaging	Het
Kcnq5	A	G	1: 21,402,681	S652P	probably benign	Het
Lamc3	A	G	2: 31,940,751	D1500G	probably damaging	Het
Macf1	A	G	4: 123,378,480	F6468L	probably damaging	Het
Mgrn1	T	A	16: 4,915,780	F198I	probably benign	Het
Mmp3	A	G	9: 7,451,232	T323A	probably benign	Het
N4bp2	A	G	5: 65,790,498	Y157C	probably benign	Het
Nfkbid	C	A	7: 30,425,356	H190Q	probably benign	Het
Olfr1474	T	C	19: 13,471,680	S237P	probably damaging	Het
Olfr512	T	C	7: 108,713,941	V184A	possibly damaging	Het
Olfr790	T	C	10: 129,501,591	S236P	probably damaging	Het
Osgin2	C	T	4: 15,998,380	G414D	probably benign	Het
Pkd1	G	A	17: 24,594,853	R4097H	probably benign	Het
Pnkd	T	A	1: 74,349,809	L213Q	probably null	Het
Ppfibp1	A	G	6: 147,027,432	H850R	probably benign	Het
Ppp6r1	T	C	7: 4,643,258	D148G	probably damaging	Het
Ptprt	A	T	2: 162,238,034	S282T	probably damaging	Het
Sgsm3	T	C	15: 81,010,256	V536A	probably benign	Het
Slc22a23	T	A	13: 34,203,964	Q383L	probably benign	Het
Snx29	T	C	16: 11,399,837		probably null	Het
Tmem229b-ps	T	A	10: 53,475,446		noncoding transcript	Het
Tmod4	A	T	3: 95,128,679	Y317F	possibly damaging	Het
Trim13	T	C	14: 61,605,659	M375T	probably benign	Het
Txndc11	A	G	16: 11,075,062	S935P	probably damaging	Het
Umod	T	C	7: 119,465,497	N592D	probably benign	Het
Vmn2r118	A	G	17: 55,610,643	Y290H	probably benign	Het
Vps26b	A	G	9: 27,012,745	M234T	probably damaging	Het
Zbtb48	A	G	4: 152,020,201		probably null	Het
Zfc3h1	T	A	10: 115,416,742	F1320Y	probably benign	Het
Zfp784	A	T	7: 5,036,040		probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7935:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTCCAGTGTTTGCTACCGAC -3'
(R):5'- ACTGAGAACCTTTGGGGACCTACC -3'

Sequencing Primer
(F):5'- aagagtcaaaaagagtgtcaatcc -3'
(R):5'- CTGCCTCAAATGGTTAAAGTAAGC -3'

Posted On

2014-04-13