Mutagenetix > Incidental Mutations

Incidental Mutation 'R1515:Olfr1474'

168257

Institutional Source

Beutler Lab

Gene Symbol

Olfr1474

Ensembl Gene

ENSMUSG00000096273

Gene Name

olfactory receptor 1474

Synonyms

MOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527

MMRRC Submission

039562-MU

Accession Numbers

Genbank: NM_001011842.1

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R1515 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13469565-13472157 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13471680 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 237 (S237P)

Ref Sequence

ENSEMBL: ENSMUSP00000151810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096202
AA Change: S237P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: S237P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	1.6e-52	PFAM
Pfam:7TM_GPCR_Srsx	33	303	1e-7	PFAM
Pfam:7tm_1	39	288	8.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207529

Predicted Effect

probably damaging
Transcript: ENSMUST00000220113
AA Change: S237P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

none

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akt2	A	G	7: 27,637,158	T401A	probably damaging	Het
Arhgap32	G	T	9: 32,116,202	V23L	probably benign	Het
Atmin	T	A	8: 116,954,840	C193S	possibly damaging	Het
Atp13a5	C	T	16: 29,333,974	V225I	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC024139	A	G	15: 76,124,326	V350A	possibly damaging	Het
Birc6	G	T	17: 74,528,636	E29*	probably null	Het
Bnc2	T	C	4: 84,414,326	N104S	probably null	Het
C030048H21Rik	T	C	2: 26,257,503		probably null	Het
Cd320	G	T	17: 33,847,639	C117F	probably damaging	Het
Cdkal1	A	G	13: 29,326,150	S542P	probably damaging	Het
Crocc	T	C	4: 141,019,737	T1587A	probably benign	Het
Defb41	T	C	1: 18,260,593		probably null	Het
Dmtf1	A	G	5: 9,140,384		probably null	Het
Dnhd1	A	G	7: 105,704,148	N2836S	probably benign	Het
Dpp8	G	A	9: 65,078,748	S840N	probably benign	Het
Dsc2	A	G	18: 20,034,701	F111L	probably damaging	Het
Dsc2	T	A	18: 20,045,565	I261F	probably benign	Het
Ece1	T	C	4: 137,951,508	V509A	probably benign	Het
Ecm2	T	C	13: 49,518,332	M103T	possibly damaging	Het
Emsy	T	C	7: 98,590,856	H1064R	probably damaging	Het
Engase	T	C	11: 118,487,140	V252A	possibly damaging	Het
F13b	A	G	1: 139,510,965	Y369C	probably damaging	Het
Flii	T	C	11: 60,721,606		probably null	Het
Fzd10	T	A	5: 128,602,559	F448I	probably damaging	Het
Gpr35	T	G	1: 92,983,048	F161V	probably damaging	Het
Gprin2	T	C	14: 34,195,273	D180G	possibly damaging	Het
Grik3	A	G	4: 125,670,728	N501S	probably benign	Het
Hells	A	G	19: 38,967,765	K802E	probably damaging	Het
Il1r1	T	A	1: 40,293,349	C96*	probably null	Het
Kcnk16	T	A	14: 20,265,277	I73F	probably damaging	Het
Kcnq5	A	G	1: 21,402,681	S652P	probably benign	Het
Lamc3	A	G	2: 31,940,751	D1500G	probably damaging	Het
Macf1	A	G	4: 123,378,480	F6468L	probably damaging	Het
Mgrn1	T	A	16: 4,915,780	F198I	probably benign	Het
Mmp3	A	G	9: 7,451,232	T323A	probably benign	Het
N4bp2	A	G	5: 65,790,498	Y157C	probably benign	Het
Nfkbid	C	A	7: 30,425,356	H190Q	probably benign	Het
Olfr512	T	C	7: 108,713,941	V184A	possibly damaging	Het
Olfr790	T	C	10: 129,501,591	S236P	probably damaging	Het
Osgin2	C	T	4: 15,998,380	G414D	probably benign	Het
Pkd1	G	A	17: 24,594,853	R4097H	probably benign	Het
Pnkd	T	A	1: 74,349,809	L213Q	probably null	Het
Ppfibp1	A	G	6: 147,027,432	H850R	probably benign	Het
Ppp6r1	T	C	7: 4,643,258	D148G	probably damaging	Het
Ptprt	A	T	2: 162,238,034	S282T	probably damaging	Het
Sgsm3	T	C	15: 81,010,256	V536A	probably benign	Het
Slc22a23	T	A	13: 34,203,964	Q383L	probably benign	Het
Snx29	T	C	16: 11,399,837		probably null	Het
Tmem229b-ps	T	A	10: 53,475,446		noncoding transcript	Het
Tmod4	A	T	3: 95,128,679	Y317F	possibly damaging	Het
Trim13	T	C	14: 61,605,659	M375T	probably benign	Het
Txndc11	A	G	16: 11,075,062	S935P	probably damaging	Het
Umod	T	C	7: 119,465,497	N592D	probably benign	Het
Vmn2r118	A	G	17: 55,610,643	Y290H	probably benign	Het
Vps26b	A	G	9: 27,012,745	M234T	probably damaging	Het
Zbtb48	A	G	4: 152,020,201		probably null	Het
Zfc3h1	T	A	10: 115,416,742	F1320Y	probably benign	Het
Zfp784	A	T	7: 5,036,040		probably benign	Het

Other mutations in Olfr1474

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03256:Olfr1474	APN	19	13471267	missense	probably damaging	0.99
D605:Olfr1474	UTSW	19	13471157	nonsense	probably null
R0173:Olfr1474	UTSW	19	13471701	missense	probably benign	0.02
R1102:Olfr1474	UTSW	19	13471407	missense	probably damaging	0.97
R1780:Olfr1474	UTSW	19	13471362	missense	probably benign	0.14
R2061:Olfr1474	UTSW	19	13471241	missense	probably damaging	0.98
R4016:Olfr1474	UTSW	19	13471197	missense	possibly damaging	0.95
R4485:Olfr1474	UTSW	19	13471555	missense	probably benign	0.08
R5119:Olfr1474	UTSW	19	13471546	missense	probably benign	0.00
R5150:Olfr1474	UTSW	19	13471430	missense	probably benign	0.01
R5156:Olfr1474	UTSW	19	13471673	missense	probably damaging	1.00
R5699:Olfr1474	UTSW	19	13470972	start codon destroyed	probably null	0.78
R5800:Olfr1474	UTSW	19	13471896	missense	probably benign	0.06
R5840:Olfr1474	UTSW	19	13471878	missense	probably benign	0.01
R5953:Olfr1474	UTSW	19	13471368	missense	possibly damaging	0.92
R5997:Olfr1474	UTSW	19	13471506	missense	probably benign	0.12
R6233:Olfr1474	UTSW	19	13471740	missense	probably damaging	1.00
R6488:Olfr1474	UTSW	19	13471617	missense	probably damaging	1.00
R6847:Olfr1474	UTSW	19	13471038	missense	probably benign	0.03
R6964:Olfr1474	UTSW	19	13471361	nonsense	probably null
R7214:Olfr1474	UTSW	19	13470973	start codon destroyed	probably null	1.00
R8001:Olfr1474	UTSW	19	13471422	missense	probably benign	0.03
R8035:Olfr1474	UTSW	19	13471899	missense	probably benign
R8129:Olfr1474	UTSW	19	13471144	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTCATGCAGCAGTGTGCAAAC -3'
(R):5'- TGTAGACCACAGGGTTCAGCATAGG -3'

Sequencing Primer
(F):5'- TTATGACAAGTACCACCTGCATTC -3'
(R):5'- GTTCAGCATAGGAATGACCATTG -3'

Posted On

2014-04-13