Mutagenetix > Incidental Mutation

Incidental Mutation 'R1511:Kif21b'

168265

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

039558-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R1511 (G1)

Quality Score

143

Status

Not validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 136169324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000074661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000075164] [ENSMUST00000130864] [ENSMUST00000171381]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127624

Predicted Effect

probably benign
Transcript: ENSMUST00000130864

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165333

Predicted Effect

probably benign
Transcript: ENSMUST00000171381

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.4%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	C	A	5: 125,514,977	N576K	probably benign	Het
Abca5	G	T	11: 110,299,978	L769M	probably damaging	Het
Abca5	T	A	11: 110,299,986	H766L	possibly damaging	Het
Acvr1c	A	G	2: 58,287,884	I191T	probably damaging	Het
Agps	A	T	2: 75,866,779	E314D	probably damaging	Het
Agxt	G	A	1: 93,135,768	G131R	probably damaging	Het
Ak8	A	G	2: 28,742,746	T326A	probably benign	Het
Aldoart2	T	A	12: 55,566,277	I329N	probably benign	Het
Apaf1	T	C	10: 91,060,185	I342V	possibly damaging	Het
Arhgap40	T	C	2: 158,527,161	S68P	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
AU022252	C	T	4: 119,228,097	R71Q	possibly damaging	Het
Baz1b	T	C	5: 135,217,782	L695P	probably damaging	Het
Baz2b	A	T	2: 59,962,024	S587T	probably benign	Het
Cep76	T	C	18: 67,624,958	M421V	probably benign	Het
Clk2	A	G	3: 89,168,703	D60G	probably damaging	Het
Clstn3	G	T	6: 124,462,169	T6K	probably damaging	Het
Cluap1	T	A	16: 3,919,558	D180E	probably benign	Het
Col12a1	T	C	9: 79,699,552	I530V	probably benign	Het
Cpt1a	T	C	19: 3,365,788		probably benign	Het
Cr2	T	G	1: 195,155,272	K797Q	possibly damaging	Het
Crybg3	C	A	16: 59,554,112	V2260L	probably benign	Het
Csnk1a1	T	A	18: 61,585,250		probably benign	Het
Cxcr1	T	C	1: 74,192,770	D31G	probably benign	Het
Cyp2a5	G	T	7: 26,835,936	D108Y	probably damaging	Het
Dnajc1	A	G	2: 18,222,727	V376A	possibly damaging	Het
Eif4enif1	T	C	11: 3,236,278	V462A	probably benign	Het
Elmo1	A	G	13: 20,290,477	K357R	possibly damaging	Het
Eml6	T	A	11: 29,818,374	H771L	probably damaging	Het
Epb41l4a	A	G	18: 33,832,664	I370T	probably benign	Het
Esp36	A	T	17: 38,417,281	N79K	possibly damaging	Het
Fam229b	A	G	10: 39,118,919	*81Q	probably null	Het
Fat4	T	C	3: 38,983,076	Y3626H	probably damaging	Het
Fbn1	A	T	2: 125,306,285	F2681Y	probably benign	Het
Gad1-ps	A	G	10: 99,445,469		noncoding transcript	Het
Galm	C	A	17: 80,183,267	N284K	probably damaging	Het
Gtf3c2	A	T	5: 31,159,102	S735T	probably benign	Het
Hsph1	A	T	5: 149,630,383	S207T	probably benign	Het
Il33	C	T	19: 29,955,215	R159C	probably damaging	Het
Invs	A	G	4: 48,382,148	N106S	possibly damaging	Het
Kirrel2	A	G	7: 30,456,498	C42R	probably damaging	Het
Letm1	A	C	5: 33,752,555	C378W	probably damaging	Het
Lrrc71	T	A	3: 87,745,484	K160N	probably benign	Het
Lrrtm3	A	G	10: 64,089,025	I121T	probably damaging	Het
Lztr1	T	A	16: 17,509,670	V79E	probably damaging	Het
Mmp8	T	G	9: 7,566,278	D378E	probably damaging	Het
Mpzl3	A	G	9: 45,066,529	E145G	probably damaging	Het
Mrps2	C	T	2: 28,469,664	L178F	probably damaging	Het
Mzb1	A	G	18: 35,647,822		probably null	Het
Nckap1	T	C	2: 80,553,415	D135G	probably damaging	Het
Ndst1	A	G	18: 60,697,170	F623L	possibly damaging	Het
Nlrp5	A	T	7: 23,413,347	D143V	probably damaging	Het
Olfr1225	A	G	2: 89,170,937	S92P	probably damaging	Het
Olfr1241	T	C	2: 89,482,248	M296V	probably null	Het
Olfr1311	A	G	2: 112,021,404	V150A	probably benign	Het
Olfr146	T	C	9: 39,019,025	D172G	probably benign	Het
Olfr307	T	C	7: 86,336,345	D17G	possibly damaging	Het
Olfr32	A	G	2: 90,138,404	V245A	probably benign	Het
Olfr548-ps1	T	C	7: 102,542,125	L63P	probably damaging	Het
Olfr907	A	G	9: 38,498,818	I50V	probably benign	Het
Parp14	T	G	16: 35,857,224	E791D	probably benign	Het
Pcdh8	C	T	14: 79,769,389	R578H	possibly damaging	Het
Phrf1	T	A	7: 141,259,801		probably benign	Het
Polr3b	C	A	10: 84,680,385	H626N	probably benign	Het
Ppp1r12a	A	G	10: 108,251,859	T58A	probably benign	Het
Ppp4r3b	T	A	11: 29,182,460	V33D	probably damaging	Het
Ppp5c	A	G	7: 17,009,982	Y176H	probably damaging	Het
R3hdm1	A	G	1: 128,197,005	Y343C	probably damaging	Het
Rabac1	C	T	7: 24,972,130	V122M	probably damaging	Het
Rasef	G	T	4: 73,735,748	Q561K	probably damaging	Het
Rbl1	A	G	2: 157,195,634	S198P	probably damaging	Het
Rbm12	A	T	2: 156,097,536	M272K	probably damaging	Het
Rexo1	T	G	10: 80,550,050	K391N	possibly damaging	Het
Rnf43	T	C	11: 87,731,347	S384P	probably benign	Het
Rpsa	A	T	9: 120,131,000	I210F	possibly damaging	Het
Rslcan18	A	G	13: 67,098,952	Y75H	possibly damaging	Het
Scn9a	T	A	2: 66,526,813	D1048V	probably benign	Het
Sec11a	T	C	7: 80,927,734		probably null	Het
Sidt2	A	G	9: 45,950,089	V19A	probably damaging	Het
Snx14	G	A	9: 88,398,364	Q522*	probably null	Het
Stx1b	A	G	7: 127,814,972	L74S	probably damaging	Het
Tm7sf3	A	T	6: 146,609,878	M371K	probably benign	Het
Tmem115	T	C	9: 107,534,975	V166A	probably benign	Het
Traf5	T	A	1: 191,999,951	T310S	probably benign	Het
Trdn	A	G	10: 33,466,452	K619E	probably benign	Het
Trmt10a	T	A	3: 138,152,184		probably null	Het
Txk	A	C	5: 72,707,671	I287R	probably damaging	Het
Txndc16	T	C	14: 45,151,887	D452G	probably damaging	Het
Ube2f	G	A	1: 91,262,301		probably null	Het
Ubtfl1	T	G	9: 18,410,193	I339R	probably benign	Het
Upf1	A	G	8: 70,338,505	I529T	probably damaging	Het
Vmn1r197	A	G	13: 22,328,653	D248G	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,786	T149S	probably benign	Het
Vmn1r83	C	T	7: 12,321,270	V287I	possibly damaging	Het
Vmn2r118	G	A	17: 55,608,496	R485*	probably null	Het
Vmn2r-ps130	A	G	17: 23,063,801	T152A	probably benign	Het
Vps13b	T	C	15: 35,839,975	F2448L	probably damaging	Het
Vps13b	A	G	15: 35,841,573	N2583S	probably benign	Het
Wscd1	C	T	11: 71,788,675	P458L	probably damaging	Het
Xylt2	T	A	11: 94,670,433	D168V	probably damaging	Het
Zdhhc2	A	G	8: 40,467,972	T306A	probably benign	Het
Zfp804b	A	T	5: 6,769,771	D1097E	possibly damaging	Het
Zfp93	T	A	7: 24,275,731	C380*	probably null	Het
Zfp960	T	A	17: 17,088,256	C411S	probably damaging	Het
Zmynd15	T	A	11: 70,464,793	V430E	probably damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136172157	critical splice acceptor site	probably null
Schiessen	UTSW	1	136147869	critical splice donor site	probably null
wolfen	UTSW	1	136144758	nonsense	probably null
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136163099	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136172157	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136148282	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4749:Kif21b	UTSW	1	136144749	nonsense	probably null
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136151325	splice site	probably null
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136171173	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136172283	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136145304	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136151155	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136172821	nonsense	probably null
R9261:Kif21b	UTSW	1	136149424	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136171707	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136174062	missense	probably benign
R9562:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136149428	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136153223	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136148683	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGCTTCAGGTTAGGTAGCCTTTC -3'
(R):5'- GATGTTGGGACTTCAGAGACGCTTC -3'

Sequencing Primer
(F):5'- TGCTAAGGATGGCAGCCAC -3'
(R):5'- TCTAGAAAGGTGACCTGGAGG -3'

Posted On

2014-04-13