Mutagenetix > Incidental Mutations

Incidental Mutation 'R1511:Cr2'

168268

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

039558-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R1511 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 195155272 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 797 (K797Q)

Ref Sequence

ENSEMBL: ENSMUSP00000141538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

Predicted Effect

probably benign
Transcript: ENSMUST00000082321
AA Change: K797Q

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: K797Q

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably benign
Transcript: ENSMUST00000193356
AA Change: K500Q

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: K500Q

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193436

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195120
AA Change: K797Q

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: K797Q

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

probably benign
Transcript: ENSMUST00000210219
AA Change: K1173Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.4%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	C	A	5: 125,514,977	N576K	probably benign	Het
Abca5	G	T	11: 110,299,978	L769M	probably damaging	Het
Abca5	T	A	11: 110,299,986	H766L	possibly damaging	Het
Acvr1c	A	G	2: 58,287,884	I191T	probably damaging	Het
Agps	A	T	2: 75,866,779	E314D	probably damaging	Het
Agxt	G	A	1: 93,135,768	G131R	probably damaging	Het
Ak8	A	G	2: 28,742,746	T326A	probably benign	Het
Aldoart2	T	A	12: 55,566,277	I329N	probably benign	Het
Apaf1	T	C	10: 91,060,185	I342V	possibly damaging	Het
Arhgap40	T	C	2: 158,527,161	S68P	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
AU022252	C	T	4: 119,228,097	R71Q	possibly damaging	Het
Baz1b	T	C	5: 135,217,782	L695P	probably damaging	Het
Baz2b	A	T	2: 59,962,024	S587T	probably benign	Het
Cep76	T	C	18: 67,624,958	M421V	probably benign	Het
Clk2	A	G	3: 89,168,703	D60G	probably damaging	Het
Clstn3	G	T	6: 124,462,169	T6K	probably damaging	Het
Cluap1	T	A	16: 3,919,558	D180E	probably benign	Het
Col12a1	T	C	9: 79,699,552	I530V	probably benign	Het
Cpt1a	T	C	19: 3,365,788		probably benign	Het
Crybg3	C	A	16: 59,554,112	V2260L	probably benign	Het
Csnk1a1	T	A	18: 61,585,250		probably benign	Het
Cxcr1	T	C	1: 74,192,770	D31G	probably benign	Het
Cyp2a5	G	T	7: 26,835,936	D108Y	probably damaging	Het
Dnajc1	A	G	2: 18,222,727	V376A	possibly damaging	Het
Eif4enif1	T	C	11: 3,236,278	V462A	probably benign	Het
Elmo1	A	G	13: 20,290,477	K357R	possibly damaging	Het
Eml6	T	A	11: 29,818,374	H771L	probably damaging	Het
Epb41l4a	A	G	18: 33,832,664	I370T	probably benign	Het
Esp36	A	T	17: 38,417,281	N79K	possibly damaging	Het
Fam229b	A	G	10: 39,118,919	*81Q	probably null	Het
Fat4	T	C	3: 38,983,076	Y3626H	probably damaging	Het
Fbn1	A	T	2: 125,306,285	F2681Y	probably benign	Het
Gad1-ps	A	G	10: 99,445,469		noncoding transcript	Het
Galm	C	A	17: 80,183,267	N284K	probably damaging	Het
Gtf3c2	A	T	5: 31,159,102	S735T	probably benign	Het
Hsph1	A	T	5: 149,630,383	S207T	probably benign	Het
Il33	C	T	19: 29,955,215	R159C	probably damaging	Het
Invs	A	G	4: 48,382,148	N106S	possibly damaging	Het
Kif21b	G	T	1: 136,169,324		probably null	Het
Kirrel2	A	G	7: 30,456,498	C42R	probably damaging	Het
Letm1	A	C	5: 33,752,555	C378W	probably damaging	Het
Lrrc71	T	A	3: 87,745,484	K160N	probably benign	Het
Lrrtm3	A	G	10: 64,089,025	I121T	probably damaging	Het
Lztr1	T	A	16: 17,509,670	V79E	probably damaging	Het
Mmp8	T	G	9: 7,566,278	D378E	probably damaging	Het
Mpzl3	A	G	9: 45,066,529	E145G	probably damaging	Het
Mrps2	C	T	2: 28,469,664	L178F	probably damaging	Het
Mzb1	A	G	18: 35,647,822		probably null	Het
Nckap1	T	C	2: 80,553,415	D135G	probably damaging	Het
Ndst1	A	G	18: 60,697,170	F623L	possibly damaging	Het
Nlrp5	A	T	7: 23,413,347	D143V	probably damaging	Het
Olfr1225	A	G	2: 89,170,937	S92P	probably damaging	Het
Olfr1241	T	C	2: 89,482,248	M296V	probably null	Het
Olfr1311	A	G	2: 112,021,404	V150A	probably benign	Het
Olfr146	T	C	9: 39,019,025	D172G	probably benign	Het
Olfr307	T	C	7: 86,336,345	D17G	possibly damaging	Het
Olfr32	A	G	2: 90,138,404	V245A	probably benign	Het
Olfr548-ps1	T	C	7: 102,542,125	L63P	probably damaging	Het
Olfr907	A	G	9: 38,498,818	I50V	probably benign	Het
Parp14	T	G	16: 35,857,224	E791D	probably benign	Het
Pcdh8	C	T	14: 79,769,389	R578H	possibly damaging	Het
Phrf1	T	A	7: 141,259,801		probably benign	Het
Polr3b	C	A	10: 84,680,385	H626N	probably benign	Het
Ppp1r12a	A	G	10: 108,251,859	T58A	probably benign	Het
Ppp4r3b	T	A	11: 29,182,460	V33D	probably damaging	Het
Ppp5c	A	G	7: 17,009,982	Y176H	probably damaging	Het
R3hdm1	A	G	1: 128,197,005	Y343C	probably damaging	Het
Rabac1	C	T	7: 24,972,130	V122M	probably damaging	Het
Rasef	G	T	4: 73,735,748	Q561K	probably damaging	Het
Rbl1	A	G	2: 157,195,634	S198P	probably damaging	Het
Rbm12	A	T	2: 156,097,536	M272K	probably damaging	Het
Rexo1	T	G	10: 80,550,050	K391N	possibly damaging	Het
Rnf43	T	C	11: 87,731,347	S384P	probably benign	Het
Rpsa	A	T	9: 120,131,000	I210F	possibly damaging	Het
Rslcan18	A	G	13: 67,098,952	Y75H	possibly damaging	Het
Scn9a	T	A	2: 66,526,813	D1048V	probably benign	Het
Sec11a	T	C	7: 80,927,734		probably null	Het
Sidt2	A	G	9: 45,950,089	V19A	probably damaging	Het
Snx14	G	A	9: 88,398,364	Q522*	probably null	Het
Stx1b	A	G	7: 127,814,972	L74S	probably damaging	Het
Tm7sf3	A	T	6: 146,609,878	M371K	probably benign	Het
Tmem115	T	C	9: 107,534,975	V166A	probably benign	Het
Traf5	T	A	1: 191,999,951	T310S	probably benign	Het
Trdn	A	G	10: 33,466,452	K619E	probably benign	Het
Trmt10a	T	A	3: 138,152,184		probably null	Het
Txk	A	C	5: 72,707,671	I287R	probably damaging	Het
Txndc16	T	C	14: 45,151,887	D452G	probably damaging	Het
Ube2f	G	A	1: 91,262,301		probably null	Het
Ubtfl1	T	G	9: 18,410,193	I339R	probably benign	Het
Upf1	A	G	8: 70,338,505	I529T	probably damaging	Het
Vmn1r197	A	G	13: 22,328,653	D248G	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,786	T149S	probably benign	Het
Vmn1r83	C	T	7: 12,321,270	V287I	possibly damaging	Het
Vmn2r118	G	A	17: 55,608,496	R485*	probably null	Het
Vmn2r-ps130	A	G	17: 23,063,801	T152A	probably benign	Het
Vps13b	T	C	15: 35,839,975	F2448L	probably damaging	Het
Vps13b	A	G	15: 35,841,573	N2583S	probably benign	Het
Wscd1	C	T	11: 71,788,675	P458L	probably damaging	Het
Xylt2	T	A	11: 94,670,433	D168V	probably damaging	Het
Zdhhc2	A	G	8: 40,467,972	T306A	probably benign	Het
Zfp804b	A	T	5: 6,769,771	D1097E	possibly damaging	Het
Zfp93	T	A	7: 24,275,731	C380*	probably null	Het
Zfp960	T	A	17: 17,088,256	C411S	probably damaging	Het
Zmynd15	T	A	11: 70,464,793	V430E	probably damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TGAAGCTGCACCTCACTAGCAAG -3'
(R):5'- CACAGGCATGATGGCAAAGCAC -3'

Sequencing Primer
(F):5'- ATCACCATTTCAGGTAATCTTGC -3'
(R):5'- TTGGGAGAGAAAAGTTTGCAGTG -3'

Posted On

2014-04-13