Incidental Mutation 'R1511:Gtf3c2'
ID 168296
Institutional Source Beutler Lab
Gene Symbol Gtf3c2
Ensembl Gene ENSMUSG00000106864
Gene Name general transcription factor IIIC, polypeptide 2, beta
Synonyms 2610510G03Rik, 1300004C11Rik, TFIIIC110, TFIIIC-BETA
MMRRC Submission 039558-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.578) question?
Stock # R1511 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 31313350-31337488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31316446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 735 (S735T)
Ref Sequence ENSEMBL: ENSMUSP00000098957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000200833] [ENSMUST00000200864] [ENSMUST00000202639] [ENSMUST00000201491] [ENSMUST00000201353] [ENSMUST00000202241]
AlphaFold Q8BL74
Predicted Effect probably benign
Transcript: ENSMUST00000043161
AA Change: S778T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047210
Gene: ENSMUSG00000029144
AA Change: S778T

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088010
AA Change: S735T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864
AA Change: S735T

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101411
AA Change: S735T

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678
AA Change: S735T

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136581
Predicted Effect probably benign
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201087
Predicted Effect probably benign
Transcript: ENSMUST00000202639
AA Change: S778T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864
AA Change: S778T

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202375
Predicted Effect probably benign
Transcript: ENSMUST00000201491
SMART Domains Protein: ENSMUSP00000144593
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 155 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,592,041 (GRCm39) N576K probably benign Het
Abca5 G T 11: 110,190,804 (GRCm39) L769M probably damaging Het
Abca5 T A 11: 110,190,812 (GRCm39) H766L possibly damaging Het
Acvr1c A G 2: 58,177,896 (GRCm39) I191T probably damaging Het
Agps A T 2: 75,697,123 (GRCm39) E314D probably damaging Het
Agxt G A 1: 93,063,490 (GRCm39) G131R probably damaging Het
Ak8 A G 2: 28,632,758 (GRCm39) T326A probably benign Het
Aldoart2 T A 12: 55,613,062 (GRCm39) I329N probably benign Het
Apaf1 T C 10: 90,896,047 (GRCm39) I342V possibly damaging Het
Arhgap40 T C 2: 158,369,081 (GRCm39) S68P probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AU022252 C T 4: 119,085,294 (GRCm39) R71Q possibly damaging Het
Baz1b T C 5: 135,246,636 (GRCm39) L695P probably damaging Het
Baz2b A T 2: 59,792,368 (GRCm39) S587T probably benign Het
Cep76 T C 18: 67,758,028 (GRCm39) M421V probably benign Het
Clk2 A G 3: 89,076,010 (GRCm39) D60G probably damaging Het
Clstn3 G T 6: 124,439,128 (GRCm39) T6K probably damaging Het
Cluap1 T A 16: 3,737,422 (GRCm39) D180E probably benign Het
Col12a1 T C 9: 79,606,834 (GRCm39) I530V probably benign Het
Cpt1a T C 19: 3,415,788 (GRCm39) probably benign Het
Cr2 T G 1: 194,837,580 (GRCm39) K797Q possibly damaging Het
Crybg3 C A 16: 59,374,475 (GRCm39) V2260L probably benign Het
Csnk1a1 T A 18: 61,718,321 (GRCm39) probably benign Het
Cxcr1 T C 1: 74,231,929 (GRCm39) D31G probably benign Het
Cyp2a5 G T 7: 26,535,361 (GRCm39) D108Y probably damaging Het
Dnajc1 A G 2: 18,227,538 (GRCm39) V376A possibly damaging Het
Eif4enif1 T C 11: 3,186,278 (GRCm39) V462A probably benign Het
Elmo1 A G 13: 20,474,647 (GRCm39) K357R possibly damaging Het
Eml6 T A 11: 29,768,374 (GRCm39) H771L probably damaging Het
Epb41l4a A G 18: 33,965,717 (GRCm39) I370T probably benign Het
Esp36 A T 17: 38,728,172 (GRCm39) N79K possibly damaging Het
Fam229b A G 10: 38,994,915 (GRCm39) *81Q probably null Het
Fat4 T C 3: 39,037,225 (GRCm39) Y3626H probably damaging Het
Fbn1 A T 2: 125,148,205 (GRCm39) F2681Y probably benign Het
Gad1-ps A G 10: 99,281,331 (GRCm39) noncoding transcript Het
Galm C A 17: 80,490,696 (GRCm39) N284K probably damaging Het
Hsph1 A T 5: 149,553,848 (GRCm39) S207T probably benign Het
Il33 C T 19: 29,932,615 (GRCm39) R159C probably damaging Het
Invs A G 4: 48,382,148 (GRCm39) N106S possibly damaging Het
Kif21b G T 1: 136,097,062 (GRCm39) probably null Het
Kirrel2 A G 7: 30,155,923 (GRCm39) C42R probably damaging Het
Letm1 A C 5: 33,909,899 (GRCm39) C378W probably damaging Het
Lrrc71 T A 3: 87,652,791 (GRCm39) K160N probably benign Het
Lrrtm3 A G 10: 63,924,804 (GRCm39) I121T probably damaging Het
Lztr1 T A 16: 17,327,534 (GRCm39) V79E probably damaging Het
Mmp8 T G 9: 7,566,279 (GRCm39) D378E probably damaging Het
Mpzl3 A G 9: 44,977,827 (GRCm39) E145G probably damaging Het
Mrps2 C T 2: 28,359,676 (GRCm39) L178F probably damaging Het
Mzb1 A G 18: 35,780,875 (GRCm39) probably null Het
Nckap1 T C 2: 80,383,759 (GRCm39) D135G probably damaging Het
Ndst1 A G 18: 60,830,242 (GRCm39) F623L possibly damaging Het
Nlrp5 A T 7: 23,112,772 (GRCm39) D143V probably damaging Het
Or14a260 T C 7: 85,985,553 (GRCm39) D17G possibly damaging Het
Or4a69 T C 2: 89,312,592 (GRCm39) M296V probably null Het
Or4b1d A G 2: 89,968,748 (GRCm39) V245A probably benign Het
Or4c120 A G 2: 89,001,281 (GRCm39) S92P probably damaging Het
Or4f58 A G 2: 111,851,749 (GRCm39) V150A probably benign Het
Or52b4i T C 7: 102,191,332 (GRCm39) L63P probably damaging Het
Or8b44 A G 9: 38,410,114 (GRCm39) I50V probably benign Het
Or8g17 T C 9: 38,930,321 (GRCm39) D172G probably benign Het
Parp14 T G 16: 35,677,594 (GRCm39) E791D probably benign Het
Pcdh8 C T 14: 80,006,829 (GRCm39) R578H possibly damaging Het
Phrf1 T A 7: 140,839,714 (GRCm39) probably benign Het
Polr3b C A 10: 84,516,249 (GRCm39) H626N probably benign Het
Ppp1r12a A G 10: 108,087,720 (GRCm39) T58A probably benign Het
Ppp4r3b T A 11: 29,132,460 (GRCm39) V33D probably damaging Het
Ppp5c A G 7: 16,743,907 (GRCm39) Y176H probably damaging Het
R3hdm1 A G 1: 128,124,742 (GRCm39) Y343C probably damaging Het
Rabac1 C T 7: 24,671,555 (GRCm39) V122M probably damaging Het
Rasef G T 4: 73,653,985 (GRCm39) Q561K probably damaging Het
Rbl1 A G 2: 157,037,554 (GRCm39) S198P probably damaging Het
Rbm12 A T 2: 155,939,456 (GRCm39) M272K probably damaging Het
Rexo1 T G 10: 80,385,884 (GRCm39) K391N possibly damaging Het
Rnf43 T C 11: 87,622,173 (GRCm39) S384P probably benign Het
Rpsa A T 9: 119,960,066 (GRCm39) I210F possibly damaging Het
Rslcan18 A G 13: 67,247,016 (GRCm39) Y75H possibly damaging Het
Scn9a T A 2: 66,357,157 (GRCm39) D1048V probably benign Het
Sec11a T C 7: 80,577,482 (GRCm39) probably null Het
Sidt2 A G 9: 45,861,387 (GRCm39) V19A probably damaging Het
Snx14 G A 9: 88,280,417 (GRCm39) Q522* probably null Het
Stx1b A G 7: 127,414,144 (GRCm39) L74S probably damaging Het
Tm7sf3 A T 6: 146,511,376 (GRCm39) M371K probably benign Het
Tmem115 T C 9: 107,412,174 (GRCm39) V166A probably benign Het
Traf5 T A 1: 191,731,912 (GRCm39) T310S probably benign Het
Trdn A G 10: 33,342,448 (GRCm39) K619E probably benign Het
Trmt10a T A 3: 137,857,945 (GRCm39) probably null Het
Txk A C 5: 72,865,014 (GRCm39) I287R probably damaging Het
Txndc16 T C 14: 45,389,344 (GRCm39) D452G probably damaging Het
Ube2f G A 1: 91,190,023 (GRCm39) probably null Het
Ubtfl1 T G 9: 18,321,489 (GRCm39) I339R probably benign Het
Upf1 A G 8: 70,791,155 (GRCm39) I529T probably damaging Het
Vmn1r197 A G 13: 22,512,823 (GRCm39) D248G possibly damaging Het
Vmn1r5 A T 6: 56,962,771 (GRCm39) T149S probably benign Het
Vmn1r83 C T 7: 12,055,197 (GRCm39) V287I possibly damaging Het
Vmn2r118 G A 17: 55,915,496 (GRCm39) R485* probably null Het
Vmn2r130 A G 17: 23,282,775 (GRCm39) T152A probably benign Het
Vps13b T C 15: 35,840,121 (GRCm39) F2448L probably damaging Het
Vps13b A G 15: 35,841,719 (GRCm39) N2583S probably benign Het
Wscd1 C T 11: 71,679,501 (GRCm39) P458L probably damaging Het
Xylt2 T A 11: 94,561,259 (GRCm39) D168V probably damaging Het
Zdhhc2 A G 8: 40,921,013 (GRCm39) T306A probably benign Het
Zfp804b A T 5: 6,819,771 (GRCm39) D1097E possibly damaging Het
Zfp93 T A 7: 23,975,156 (GRCm39) C380* probably null Het
Zfp960 T A 17: 17,308,518 (GRCm39) C411S probably damaging Het
Zmynd15 T A 11: 70,355,619 (GRCm39) V430E probably damaging Het
Other mutations in Gtf3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Gtf3c2 APN 5 31,331,752 (GRCm39) missense probably damaging 1.00
IGL00832:Gtf3c2 APN 5 31,330,349 (GRCm39) unclassified probably benign
IGL00904:Gtf3c2 APN 5 31,330,202 (GRCm39) missense probably damaging 1.00
IGL00966:Gtf3c2 APN 5 31,327,517 (GRCm39) critical splice donor site probably benign 0.00
IGL01061:Gtf3c2 APN 5 31,325,698 (GRCm39) missense possibly damaging 0.94
IGL01148:Gtf3c2 APN 5 31,317,168 (GRCm39) missense probably damaging 1.00
IGL01767:Gtf3c2 APN 5 31,314,979 (GRCm39) missense probably benign 0.08
IGL02237:Gtf3c2 APN 5 31,316,397 (GRCm39) splice site probably benign
IGL02458:Gtf3c2 APN 5 31,316,867 (GRCm39) critical splice acceptor site probably null
IGL02888:Gtf3c2 APN 5 31,331,169 (GRCm39) missense probably damaging 1.00
IGL03035:Gtf3c2 APN 5 31,323,358 (GRCm39) missense possibly damaging 0.96
IGL03131:Gtf3c2 APN 5 31,314,964 (GRCm39) missense probably damaging 0.98
R0534:Gtf3c2 UTSW 5 31,315,476 (GRCm39) splice site probably benign
R0581:Gtf3c2 UTSW 5 31,316,862 (GRCm39) nonsense probably null
R0634:Gtf3c2 UTSW 5 31,317,150 (GRCm39) nonsense probably null
R1172:Gtf3c2 UTSW 5 31,325,419 (GRCm39) missense probably damaging 1.00
R1680:Gtf3c2 UTSW 5 31,331,212 (GRCm39) missense probably damaging 1.00
R1726:Gtf3c2 UTSW 5 31,326,467 (GRCm39) missense possibly damaging 0.82
R1831:Gtf3c2 UTSW 5 31,325,713 (GRCm39) missense probably damaging 1.00
R2006:Gtf3c2 UTSW 5 31,325,440 (GRCm39) missense probably damaging 0.99
R2437:Gtf3c2 UTSW 5 31,317,042 (GRCm39) critical splice donor site probably null
R4732:Gtf3c2 UTSW 5 31,317,401 (GRCm39) missense probably damaging 0.97
R4733:Gtf3c2 UTSW 5 31,317,401 (GRCm39) missense probably damaging 0.97
R4787:Gtf3c2 UTSW 5 31,314,921 (GRCm39) missense probably benign 0.03
R4817:Gtf3c2 UTSW 5 31,331,434 (GRCm39) critical splice acceptor site probably null
R4863:Gtf3c2 UTSW 5 31,316,577 (GRCm39) intron probably benign
R4926:Gtf3c2 UTSW 5 31,326,467 (GRCm39) missense possibly damaging 0.82
R5508:Gtf3c2 UTSW 5 31,331,805 (GRCm39) nonsense probably null
R5704:Gtf3c2 UTSW 5 31,316,454 (GRCm39) missense probably damaging 1.00
R5737:Gtf3c2 UTSW 5 31,325,593 (GRCm39) critical splice donor site probably null
R5868:Gtf3c2 UTSW 5 31,325,425 (GRCm39) missense possibly damaging 0.94
R6174:Gtf3c2 UTSW 5 31,315,555 (GRCm39) missense probably damaging 1.00
R6705:Gtf3c2 UTSW 5 31,323,352 (GRCm39) missense possibly damaging 0.93
R6782:Gtf3c2 UTSW 5 31,327,180 (GRCm39) missense probably benign 0.01
R6893:Gtf3c2 UTSW 5 31,323,722 (GRCm39) missense probably benign 0.06
R7363:Gtf3c2 UTSW 5 31,327,600 (GRCm39) missense probably damaging 1.00
R7474:Gtf3c2 UTSW 5 31,325,100 (GRCm39) missense probably damaging 1.00
R7578:Gtf3c2 UTSW 5 31,330,341 (GRCm39) missense probably benign
R7685:Gtf3c2 UTSW 5 31,325,611 (GRCm39) missense probably damaging 1.00
R7711:Gtf3c2 UTSW 5 31,327,533 (GRCm39) missense probably damaging 1.00
R7754:Gtf3c2 UTSW 5 31,330,175 (GRCm39) missense probably benign 0.38
R7825:Gtf3c2 UTSW 5 31,315,715 (GRCm39) missense probably damaging 0.99
R7994:Gtf3c2 UTSW 5 31,327,217 (GRCm39) missense possibly damaging 0.60
R8430:Gtf3c2 UTSW 5 31,330,403 (GRCm39) missense probably damaging 1.00
R8772:Gtf3c2 UTSW 5 31,331,758 (GRCm39) missense probably benign 0.26
R8950:Gtf3c2 UTSW 5 31,331,151 (GRCm39) missense probably damaging 1.00
R9221:Gtf3c2 UTSW 5 31,326,401 (GRCm39) missense probably damaging 1.00
R9451:Gtf3c2 UTSW 5 31,325,773 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACCTGACTCTCCAAAGCTGC -3'
(R):5'- TTACTGCTCCGCGAAAAGGCAC -3'

Sequencing Primer
(F):5'- CAAGCCCCATATACATGAATTAAGTG -3'
(R):5'- TGGTAACTGCATCATTAGGGAC -3'
Posted On 2014-04-13