Incidental Mutation 'R1511:Letm1'
ID168297
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Nameleucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission 039558-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1511 (G1)
Quality Score211
Status Not validated
Chromosome5
Chromosomal Location33739673-33782817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33752555 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 378 (C378W)
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
Predicted Effect probably damaging
Transcript: ENSMUST00000005431
AA Change: C378W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299
AA Change: C378W

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149886
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,514,977 N576K probably benign Het
Abca5 G T 11: 110,299,978 L769M probably damaging Het
Abca5 T A 11: 110,299,986 H766L possibly damaging Het
Acvr1c A G 2: 58,287,884 I191T probably damaging Het
Agps A T 2: 75,866,779 E314D probably damaging Het
Agxt G A 1: 93,135,768 G131R probably damaging Het
Ak8 A G 2: 28,742,746 T326A probably benign Het
Aldoart2 T A 12: 55,566,277 I329N probably benign Het
Apaf1 T C 10: 91,060,185 I342V possibly damaging Het
Arhgap40 T C 2: 158,527,161 S68P probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AU022252 C T 4: 119,228,097 R71Q possibly damaging Het
Baz1b T C 5: 135,217,782 L695P probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Cep76 T C 18: 67,624,958 M421V probably benign Het
Clk2 A G 3: 89,168,703 D60G probably damaging Het
Clstn3 G T 6: 124,462,169 T6K probably damaging Het
Cluap1 T A 16: 3,919,558 D180E probably benign Het
Col12a1 T C 9: 79,699,552 I530V probably benign Het
Cpt1a T C 19: 3,365,788 probably benign Het
Cr2 T G 1: 195,155,272 K797Q possibly damaging Het
Crybg3 C A 16: 59,554,112 V2260L probably benign Het
Csnk1a1 T A 18: 61,585,250 probably benign Het
Cxcr1 T C 1: 74,192,770 D31G probably benign Het
Cyp2a5 G T 7: 26,835,936 D108Y probably damaging Het
Dnajc1 A G 2: 18,222,727 V376A possibly damaging Het
Eif4enif1 T C 11: 3,236,278 V462A probably benign Het
Elmo1 A G 13: 20,290,477 K357R possibly damaging Het
Eml6 T A 11: 29,818,374 H771L probably damaging Het
Epb41l4a A G 18: 33,832,664 I370T probably benign Het
Esp36 A T 17: 38,417,281 N79K possibly damaging Het
Fam229b A G 10: 39,118,919 *81Q probably null Het
Fat4 T C 3: 38,983,076 Y3626H probably damaging Het
Fbn1 A T 2: 125,306,285 F2681Y probably benign Het
Gad1-ps A G 10: 99,445,469 noncoding transcript Het
Galm C A 17: 80,183,267 N284K probably damaging Het
Gtf3c2 A T 5: 31,159,102 S735T probably benign Het
Hsph1 A T 5: 149,630,383 S207T probably benign Het
Il33 C T 19: 29,955,215 R159C probably damaging Het
Invs A G 4: 48,382,148 N106S possibly damaging Het
Kif21b G T 1: 136,169,324 probably null Het
Kirrel2 A G 7: 30,456,498 C42R probably damaging Het
Lrrc71 T A 3: 87,745,484 K160N probably benign Het
Lrrtm3 A G 10: 64,089,025 I121T probably damaging Het
Lztr1 T A 16: 17,509,670 V79E probably damaging Het
Mmp8 T G 9: 7,566,278 D378E probably damaging Het
Mpzl3 A G 9: 45,066,529 E145G probably damaging Het
Mrps2 C T 2: 28,469,664 L178F probably damaging Het
Mzb1 A G 18: 35,647,822 probably null Het
Nckap1 T C 2: 80,553,415 D135G probably damaging Het
Ndst1 A G 18: 60,697,170 F623L possibly damaging Het
Nlrp5 A T 7: 23,413,347 D143V probably damaging Het
Olfr1225 A G 2: 89,170,937 S92P probably damaging Het
Olfr1241 T C 2: 89,482,248 M296V probably null Het
Olfr1311 A G 2: 112,021,404 V150A probably benign Het
Olfr146 T C 9: 39,019,025 D172G probably benign Het
Olfr307 T C 7: 86,336,345 D17G possibly damaging Het
Olfr32 A G 2: 90,138,404 V245A probably benign Het
Olfr548-ps1 T C 7: 102,542,125 L63P probably damaging Het
Olfr907 A G 9: 38,498,818 I50V probably benign Het
Parp14 T G 16: 35,857,224 E791D probably benign Het
Pcdh8 C T 14: 79,769,389 R578H possibly damaging Het
Phrf1 T A 7: 141,259,801 probably benign Het
Polr3b C A 10: 84,680,385 H626N probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Ppp4r3b T A 11: 29,182,460 V33D probably damaging Het
Ppp5c A G 7: 17,009,982 Y176H probably damaging Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Rabac1 C T 7: 24,972,130 V122M probably damaging Het
Rasef G T 4: 73,735,748 Q561K probably damaging Het
Rbl1 A G 2: 157,195,634 S198P probably damaging Het
Rbm12 A T 2: 156,097,536 M272K probably damaging Het
Rexo1 T G 10: 80,550,050 K391N possibly damaging Het
Rnf43 T C 11: 87,731,347 S384P probably benign Het
Rpsa A T 9: 120,131,000 I210F possibly damaging Het
Rslcan18 A G 13: 67,098,952 Y75H possibly damaging Het
Scn9a T A 2: 66,526,813 D1048V probably benign Het
Sec11a T C 7: 80,927,734 probably null Het
Sidt2 A G 9: 45,950,089 V19A probably damaging Het
Snx14 G A 9: 88,398,364 Q522* probably null Het
Stx1b A G 7: 127,814,972 L74S probably damaging Het
Tm7sf3 A T 6: 146,609,878 M371K probably benign Het
Tmem115 T C 9: 107,534,975 V166A probably benign Het
Traf5 T A 1: 191,999,951 T310S probably benign Het
Trdn A G 10: 33,466,452 K619E probably benign Het
Trmt10a T A 3: 138,152,184 probably null Het
Txk A C 5: 72,707,671 I287R probably damaging Het
Txndc16 T C 14: 45,151,887 D452G probably damaging Het
Ube2f G A 1: 91,262,301 probably null Het
Ubtfl1 T G 9: 18,410,193 I339R probably benign Het
Upf1 A G 8: 70,338,505 I529T probably damaging Het
Vmn1r197 A G 13: 22,328,653 D248G possibly damaging Het
Vmn1r5 A T 6: 56,985,786 T149S probably benign Het
Vmn1r83 C T 7: 12,321,270 V287I possibly damaging Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vmn2r-ps130 A G 17: 23,063,801 T152A probably benign Het
Vps13b T C 15: 35,839,975 F2448L probably damaging Het
Vps13b A G 15: 35,841,573 N2583S probably benign Het
Wscd1 C T 11: 71,788,675 P458L probably damaging Het
Xylt2 T A 11: 94,670,433 D168V probably damaging Het
Zdhhc2 A G 8: 40,467,972 T306A probably benign Het
Zfp804b A T 5: 6,769,771 D1097E possibly damaging Het
Zfp93 T A 7: 24,275,731 C380* probably null Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Zmynd15 T A 11: 70,464,793 V430E probably damaging Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0466:Letm1 UTSW 5 33761730 splice site probably benign
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33778682 splice site probably null
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33769515 frame shift probably null
R2292:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
R8713:Letm1 UTSW 5 33762505 missense probably damaging 1.00
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGTCTGGAGCAAAGGTAGATG -3'
(R):5'- CCCTTAAGTCTCAAGGCACTGAGC -3'

Sequencing Primer
(F):5'- TGGAGCAAAGGTAGATGATTCCC -3'
(R):5'- ttctcctcttcctcctcctc -3'
Posted On2014-04-13