Incidental Mutation 'R1511:Vmn1r5'
ID 168303
Institutional Source Beutler Lab
Gene Symbol Vmn1r5
Ensembl Gene ENSMUSG00000090346
Gene Name vomeronasal 1 receptor 5
Synonyms V1rc19
MMRRC Submission 039558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R1511 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 56947320-56963335 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56962771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 149 (T149S)
Ref Sequence ENSEMBL: ENSMUSP00000154081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164307] [ENSMUST00000226130] [ENSMUST00000228276]
AlphaFold B2RQT2
Predicted Effect probably benign
Transcript: ENSMUST00000164307
AA Change: T149S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131092
Gene: ENSMUSG00000090346
AA Change: T149S

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226130
AA Change: T149S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228276
AA Change: T149S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,592,041 (GRCm39) N576K probably benign Het
Abca5 G T 11: 110,190,804 (GRCm39) L769M probably damaging Het
Abca5 T A 11: 110,190,812 (GRCm39) H766L possibly damaging Het
Acvr1c A G 2: 58,177,896 (GRCm39) I191T probably damaging Het
Agps A T 2: 75,697,123 (GRCm39) E314D probably damaging Het
Agxt G A 1: 93,063,490 (GRCm39) G131R probably damaging Het
Ak8 A G 2: 28,632,758 (GRCm39) T326A probably benign Het
Aldoart2 T A 12: 55,613,062 (GRCm39) I329N probably benign Het
Apaf1 T C 10: 90,896,047 (GRCm39) I342V possibly damaging Het
Arhgap40 T C 2: 158,369,081 (GRCm39) S68P probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AU022252 C T 4: 119,085,294 (GRCm39) R71Q possibly damaging Het
Baz1b T C 5: 135,246,636 (GRCm39) L695P probably damaging Het
Baz2b A T 2: 59,792,368 (GRCm39) S587T probably benign Het
Cep76 T C 18: 67,758,028 (GRCm39) M421V probably benign Het
Clk2 A G 3: 89,076,010 (GRCm39) D60G probably damaging Het
Clstn3 G T 6: 124,439,128 (GRCm39) T6K probably damaging Het
Cluap1 T A 16: 3,737,422 (GRCm39) D180E probably benign Het
Col12a1 T C 9: 79,606,834 (GRCm39) I530V probably benign Het
Cpt1a T C 19: 3,415,788 (GRCm39) probably benign Het
Cr2 T G 1: 194,837,580 (GRCm39) K797Q possibly damaging Het
Crybg3 C A 16: 59,374,475 (GRCm39) V2260L probably benign Het
Csnk1a1 T A 18: 61,718,321 (GRCm39) probably benign Het
Cxcr1 T C 1: 74,231,929 (GRCm39) D31G probably benign Het
Cyp2a5 G T 7: 26,535,361 (GRCm39) D108Y probably damaging Het
Dnajc1 A G 2: 18,227,538 (GRCm39) V376A possibly damaging Het
Eif4enif1 T C 11: 3,186,278 (GRCm39) V462A probably benign Het
Elmo1 A G 13: 20,474,647 (GRCm39) K357R possibly damaging Het
Eml6 T A 11: 29,768,374 (GRCm39) H771L probably damaging Het
Epb41l4a A G 18: 33,965,717 (GRCm39) I370T probably benign Het
Esp36 A T 17: 38,728,172 (GRCm39) N79K possibly damaging Het
Fam229b A G 10: 38,994,915 (GRCm39) *81Q probably null Het
Fat4 T C 3: 39,037,225 (GRCm39) Y3626H probably damaging Het
Fbn1 A T 2: 125,148,205 (GRCm39) F2681Y probably benign Het
Gad1-ps A G 10: 99,281,331 (GRCm39) noncoding transcript Het
Galm C A 17: 80,490,696 (GRCm39) N284K probably damaging Het
Gtf3c2 A T 5: 31,316,446 (GRCm39) S735T probably benign Het
Hsph1 A T 5: 149,553,848 (GRCm39) S207T probably benign Het
Il33 C T 19: 29,932,615 (GRCm39) R159C probably damaging Het
Invs A G 4: 48,382,148 (GRCm39) N106S possibly damaging Het
Kif21b G T 1: 136,097,062 (GRCm39) probably null Het
Kirrel2 A G 7: 30,155,923 (GRCm39) C42R probably damaging Het
Letm1 A C 5: 33,909,899 (GRCm39) C378W probably damaging Het
Lrrc71 T A 3: 87,652,791 (GRCm39) K160N probably benign Het
Lrrtm3 A G 10: 63,924,804 (GRCm39) I121T probably damaging Het
Lztr1 T A 16: 17,327,534 (GRCm39) V79E probably damaging Het
Mmp8 T G 9: 7,566,279 (GRCm39) D378E probably damaging Het
Mpzl3 A G 9: 44,977,827 (GRCm39) E145G probably damaging Het
Mrps2 C T 2: 28,359,676 (GRCm39) L178F probably damaging Het
Mzb1 A G 18: 35,780,875 (GRCm39) probably null Het
Nckap1 T C 2: 80,383,759 (GRCm39) D135G probably damaging Het
Ndst1 A G 18: 60,830,242 (GRCm39) F623L possibly damaging Het
Nlrp5 A T 7: 23,112,772 (GRCm39) D143V probably damaging Het
Or14a260 T C 7: 85,985,553 (GRCm39) D17G possibly damaging Het
Or4a69 T C 2: 89,312,592 (GRCm39) M296V probably null Het
Or4b1d A G 2: 89,968,748 (GRCm39) V245A probably benign Het
Or4c120 A G 2: 89,001,281 (GRCm39) S92P probably damaging Het
Or4f58 A G 2: 111,851,749 (GRCm39) V150A probably benign Het
Or52b4i T C 7: 102,191,332 (GRCm39) L63P probably damaging Het
Or8b44 A G 9: 38,410,114 (GRCm39) I50V probably benign Het
Or8g17 T C 9: 38,930,321 (GRCm39) D172G probably benign Het
Parp14 T G 16: 35,677,594 (GRCm39) E791D probably benign Het
Pcdh8 C T 14: 80,006,829 (GRCm39) R578H possibly damaging Het
Phrf1 T A 7: 140,839,714 (GRCm39) probably benign Het
Polr3b C A 10: 84,516,249 (GRCm39) H626N probably benign Het
Ppp1r12a A G 10: 108,087,720 (GRCm39) T58A probably benign Het
Ppp4r3b T A 11: 29,132,460 (GRCm39) V33D probably damaging Het
Ppp5c A G 7: 16,743,907 (GRCm39) Y176H probably damaging Het
R3hdm1 A G 1: 128,124,742 (GRCm39) Y343C probably damaging Het
Rabac1 C T 7: 24,671,555 (GRCm39) V122M probably damaging Het
Rasef G T 4: 73,653,985 (GRCm39) Q561K probably damaging Het
Rbl1 A G 2: 157,037,554 (GRCm39) S198P probably damaging Het
Rbm12 A T 2: 155,939,456 (GRCm39) M272K probably damaging Het
Rexo1 T G 10: 80,385,884 (GRCm39) K391N possibly damaging Het
Rnf43 T C 11: 87,622,173 (GRCm39) S384P probably benign Het
Rpsa A T 9: 119,960,066 (GRCm39) I210F possibly damaging Het
Rslcan18 A G 13: 67,247,016 (GRCm39) Y75H possibly damaging Het
Scn9a T A 2: 66,357,157 (GRCm39) D1048V probably benign Het
Sec11a T C 7: 80,577,482 (GRCm39) probably null Het
Sidt2 A G 9: 45,861,387 (GRCm39) V19A probably damaging Het
Snx14 G A 9: 88,280,417 (GRCm39) Q522* probably null Het
Stx1b A G 7: 127,414,144 (GRCm39) L74S probably damaging Het
Tm7sf3 A T 6: 146,511,376 (GRCm39) M371K probably benign Het
Tmem115 T C 9: 107,412,174 (GRCm39) V166A probably benign Het
Traf5 T A 1: 191,731,912 (GRCm39) T310S probably benign Het
Trdn A G 10: 33,342,448 (GRCm39) K619E probably benign Het
Trmt10a T A 3: 137,857,945 (GRCm39) probably null Het
Txk A C 5: 72,865,014 (GRCm39) I287R probably damaging Het
Txndc16 T C 14: 45,389,344 (GRCm39) D452G probably damaging Het
Ube2f G A 1: 91,190,023 (GRCm39) probably null Het
Ubtfl1 T G 9: 18,321,489 (GRCm39) I339R probably benign Het
Upf1 A G 8: 70,791,155 (GRCm39) I529T probably damaging Het
Vmn1r197 A G 13: 22,512,823 (GRCm39) D248G possibly damaging Het
Vmn1r83 C T 7: 12,055,197 (GRCm39) V287I possibly damaging Het
Vmn2r118 G A 17: 55,915,496 (GRCm39) R485* probably null Het
Vmn2r130 A G 17: 23,282,775 (GRCm39) T152A probably benign Het
Vps13b T C 15: 35,840,121 (GRCm39) F2448L probably damaging Het
Vps13b A G 15: 35,841,719 (GRCm39) N2583S probably benign Het
Wscd1 C T 11: 71,679,501 (GRCm39) P458L probably damaging Het
Xylt2 T A 11: 94,561,259 (GRCm39) D168V probably damaging Het
Zdhhc2 A G 8: 40,921,013 (GRCm39) T306A probably benign Het
Zfp804b A T 5: 6,819,771 (GRCm39) D1097E possibly damaging Het
Zfp93 T A 7: 23,975,156 (GRCm39) C380* probably null Het
Zfp960 T A 17: 17,308,518 (GRCm39) C411S probably damaging Het
Zmynd15 T A 11: 70,355,619 (GRCm39) V430E probably damaging Het
Other mutations in Vmn1r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Vmn1r5 APN 6 56,962,911 (GRCm39) missense probably damaging 0.98
IGL02027:Vmn1r5 APN 6 56,962,640 (GRCm39) missense probably damaging 0.97
IGL03133:Vmn1r5 APN 6 56,962,600 (GRCm39) missense probably benign 0.10
IGL03412:Vmn1r5 APN 6 56,962,918 (GRCm39) missense possibly damaging 0.90
R0316:Vmn1r5 UTSW 6 56,962,784 (GRCm39) missense probably benign 0.27
R0378:Vmn1r5 UTSW 6 56,962,570 (GRCm39) missense probably benign 0.00
R0946:Vmn1r5 UTSW 6 56,963,150 (GRCm39) missense possibly damaging 0.64
R1553:Vmn1r5 UTSW 6 56,962,483 (GRCm39) missense probably benign 0.00
R1823:Vmn1r5 UTSW 6 56,962,580 (GRCm39) missense probably damaging 0.98
R3980:Vmn1r5 UTSW 6 56,962,636 (GRCm39) missense probably damaging 1.00
R4473:Vmn1r5 UTSW 6 56,962,633 (GRCm39) missense probably benign 0.01
R4742:Vmn1r5 UTSW 6 56,963,236 (GRCm39) nonsense probably null
R5321:Vmn1r5 UTSW 6 56,962,592 (GRCm39) missense probably damaging 1.00
R5364:Vmn1r5 UTSW 6 56,962,583 (GRCm39) missense probably damaging 0.98
R6102:Vmn1r5 UTSW 6 56,963,099 (GRCm39) missense probably damaging 0.96
R6581:Vmn1r5 UTSW 6 56,962,366 (GRCm39) missense probably benign
R6885:Vmn1r5 UTSW 6 56,963,042 (GRCm39) missense possibly damaging 0.89
R7297:Vmn1r5 UTSW 6 56,963,204 (GRCm39) missense possibly damaging 0.94
R8063:Vmn1r5 UTSW 6 56,962,583 (GRCm39) missense probably damaging 0.98
R8766:Vmn1r5 UTSW 6 56,963,100 (GRCm39) missense possibly damaging 0.76
R8968:Vmn1r5 UTSW 6 56,963,182 (GRCm39) nonsense probably null
R9440:Vmn1r5 UTSW 6 56,962,415 (GRCm39) missense possibly damaging 0.67
R9460:Vmn1r5 UTSW 6 56,962,829 (GRCm39) missense
Z1176:Vmn1r5 UTSW 6 56,962,933 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGACCTGATCTCCTGTCAACTGACC -3'
(R):5'- GCTATGAAGATGCTTGCATTGCCTC -3'

Sequencing Primer
(F):5'- ATGAGAAGCCTCTCTATGTGC -3'
(R):5'- GCATTGCCTCTGATGTCTGG -3'
Posted On 2014-04-13