Incidental Mutation 'R1511:Sec11a'
Institutional Source Beutler Lab
Gene Symbol Sec11a
Ensembl Gene ENSMUSG00000025724
Gene NameSEC11 homolog A, signal peptidase complex subunit
SynonymsSec11l1, 18kDa, sid2895, 1810012E07Rik, Spc18
MMRRC Submission 039558-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock #R1511 (G1)
Quality Score225
Status Not validated
Chromosomal Location80904889-80947780 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 80927734 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026818] [ENSMUST00000117383] [ENSMUST00000117383] [ENSMUST00000119980] [ENSMUST00000119980] [ENSMUST00000120285] [ENSMUST00000120285]
Predicted Effect probably null
Transcript: ENSMUST00000026818
SMART Domains Protein: ENSMUSP00000026818
Gene: ENSMUSG00000025724

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 120 6.2e-13 PFAM
low complexity region 166 176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117383
SMART Domains Protein: ENSMUSP00000113601
Gene: ENSMUSG00000025724

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 112 3.1e-12 PFAM
low complexity region 177 187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117383
SMART Domains Protein: ENSMUSP00000113601
Gene: ENSMUSG00000025724

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 112 3.1e-12 PFAM
low complexity region 177 187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119980
SMART Domains Protein: ENSMUSP00000112425
Gene: ENSMUSG00000025724

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 120 2.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119980
SMART Domains Protein: ENSMUSP00000112425
Gene: ENSMUSG00000025724

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 120 2.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120285
SMART Domains Protein: ENSMUSP00000112944
Gene: ENSMUSG00000025724

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 123 8.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120285
SMART Domains Protein: ENSMUSP00000112944
Gene: ENSMUSG00000025724

transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 123 8.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150049
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S26B family. The encoded protein is an 18kDa subunit of the signal peptidase complex and has been linked to cell migration and invasion, gastric cancer and lymph node metastasis. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,514,977 N576K probably benign Het
Abca5 T A 11: 110,299,986 H766L possibly damaging Het
Abca5 G T 11: 110,299,978 L769M probably damaging Het
Acvr1c A G 2: 58,287,884 I191T probably damaging Het
Agps A T 2: 75,866,779 E314D probably damaging Het
Agxt G A 1: 93,135,768 G131R probably damaging Het
Ak8 A G 2: 28,742,746 T326A probably benign Het
Aldoart2 T A 12: 55,566,277 I329N probably benign Het
Apaf1 T C 10: 91,060,185 I342V possibly damaging Het
Arhgap40 T C 2: 158,527,161 S68P probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AU022252 C T 4: 119,228,097 R71Q possibly damaging Het
Baz1b T C 5: 135,217,782 L695P probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Cep76 T C 18: 67,624,958 M421V probably benign Het
Clk2 A G 3: 89,168,703 D60G probably damaging Het
Clstn3 G T 6: 124,462,169 T6K probably damaging Het
Cluap1 T A 16: 3,919,558 D180E probably benign Het
Col12a1 T C 9: 79,699,552 I530V probably benign Het
Cpt1a T C 19: 3,365,788 probably benign Het
Cr2 T G 1: 195,155,272 K797Q possibly damaging Het
Crybg3 C A 16: 59,554,112 V2260L probably benign Het
Csnk1a1 T A 18: 61,585,250 probably benign Het
Cxcr1 T C 1: 74,192,770 D31G probably benign Het
Cyp2a5 G T 7: 26,835,936 D108Y probably damaging Het
Dnajc1 A G 2: 18,222,727 V376A possibly damaging Het
Eif4enif1 T C 11: 3,236,278 V462A probably benign Het
Elmo1 A G 13: 20,290,477 K357R possibly damaging Het
Eml6 T A 11: 29,818,374 H771L probably damaging Het
Epb41l4a A G 18: 33,832,664 I370T probably benign Het
Esp36 A T 17: 38,417,281 N79K possibly damaging Het
Fam229b A G 10: 39,118,919 *81Q probably null Het
Fat4 T C 3: 38,983,076 Y3626H probably damaging Het
Fbn1 A T 2: 125,306,285 F2681Y probably benign Het
Gad1-ps A G 10: 99,445,469 noncoding transcript Het
Galm C A 17: 80,183,267 N284K probably damaging Het
Gtf3c2 A T 5: 31,159,102 S735T probably benign Het
Hsph1 A T 5: 149,630,383 S207T probably benign Het
Il33 C T 19: 29,955,215 R159C probably damaging Het
Invs A G 4: 48,382,148 N106S possibly damaging Het
Kif21b G T 1: 136,169,324 probably null Het
Kirrel2 A G 7: 30,456,498 C42R probably damaging Het
Letm1 A C 5: 33,752,555 C378W probably damaging Het
Lrrc71 T A 3: 87,745,484 K160N probably benign Het
Lrrtm3 A G 10: 64,089,025 I121T probably damaging Het
Lztr1 T A 16: 17,509,670 V79E probably damaging Het
Mmp8 T G 9: 7,566,278 D378E probably damaging Het
Mpzl3 A G 9: 45,066,529 E145G probably damaging Het
Mrps2 C T 2: 28,469,664 L178F probably damaging Het
Mzb1 A G 18: 35,647,822 probably null Het
Nckap1 T C 2: 80,553,415 D135G probably damaging Het
Ndst1 A G 18: 60,697,170 F623L possibly damaging Het
Nlrp5 A T 7: 23,413,347 D143V probably damaging Het
Olfr1225 A G 2: 89,170,937 S92P probably damaging Het
Olfr1241 T C 2: 89,482,248 M296V probably null Het
Olfr1311 A G 2: 112,021,404 V150A probably benign Het
Olfr146 T C 9: 39,019,025 D172G probably benign Het
Olfr307 T C 7: 86,336,345 D17G possibly damaging Het
Olfr32 A G 2: 90,138,404 V245A probably benign Het
Olfr548-ps1 T C 7: 102,542,125 L63P probably damaging Het
Olfr907 A G 9: 38,498,818 I50V probably benign Het
Parp14 T G 16: 35,857,224 E791D probably benign Het
Pcdh8 C T 14: 79,769,389 R578H possibly damaging Het
Phrf1 T A 7: 141,259,801 probably benign Het
Polr3b C A 10: 84,680,385 H626N probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Ppp4r3b T A 11: 29,182,460 V33D probably damaging Het
Ppp5c A G 7: 17,009,982 Y176H probably damaging Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Rabac1 C T 7: 24,972,130 V122M probably damaging Het
Rasef G T 4: 73,735,748 Q561K probably damaging Het
Rbl1 A G 2: 157,195,634 S198P probably damaging Het
Rbm12 A T 2: 156,097,536 M272K probably damaging Het
Rexo1 T G 10: 80,550,050 K391N possibly damaging Het
Rnf43 T C 11: 87,731,347 S384P probably benign Het
Rpsa A T 9: 120,131,000 I210F possibly damaging Het
Rslcan18 A G 13: 67,098,952 Y75H possibly damaging Het
Scn9a T A 2: 66,526,813 D1048V probably benign Het
Sidt2 A G 9: 45,950,089 V19A probably damaging Het
Snx14 G A 9: 88,398,364 Q522* probably null Het
Stx1b A G 7: 127,814,972 L74S probably damaging Het
Tm7sf3 A T 6: 146,609,878 M371K probably benign Het
Tmem115 T C 9: 107,534,975 V166A probably benign Het
Traf5 T A 1: 191,999,951 T310S probably benign Het
Trdn A G 10: 33,466,452 K619E probably benign Het
Trmt10a T A 3: 138,152,184 probably null Het
Txk A C 5: 72,707,671 I287R probably damaging Het
Txndc16 T C 14: 45,151,887 D452G probably damaging Het
Ube2f G A 1: 91,262,301 probably null Het
Ubtfl1 T G 9: 18,410,193 I339R probably benign Het
Upf1 A G 8: 70,338,505 I529T probably damaging Het
Vmn1r197 A G 13: 22,328,653 D248G possibly damaging Het
Vmn1r5 A T 6: 56,985,786 T149S probably benign Het
Vmn1r83 C T 7: 12,321,270 V287I possibly damaging Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vmn2r-ps130 A G 17: 23,063,801 T152A probably benign Het
Vps13b T C 15: 35,839,975 F2448L probably damaging Het
Vps13b A G 15: 35,841,573 N2583S probably benign Het
Wscd1 C T 11: 71,788,675 P458L probably damaging Het
Xylt2 T A 11: 94,670,433 D168V probably damaging Het
Zdhhc2 A G 8: 40,467,972 T306A probably benign Het
Zfp804b A T 5: 6,769,771 D1097E possibly damaging Het
Zfp93 T A 7: 24,275,731 C380* probably null Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Zmynd15 T A 11: 70,464,793 V430E probably damaging Het
Other mutations in Sec11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Sec11a APN 7 80935062 missense probably benign 0.21
R0083:Sec11a UTSW 7 80935039 missense probably damaging 1.00
R0108:Sec11a UTSW 7 80935039 missense probably damaging 1.00
R0661:Sec11a UTSW 7 80935039 missense probably damaging 1.00
R1704:Sec11a UTSW 7 80935100 missense possibly damaging 0.47
R4209:Sec11a UTSW 7 80935042 missense probably damaging 1.00
R5135:Sec11a UTSW 7 80923064 intron probably benign
R6362:Sec11a UTSW 7 80923131 missense probably benign 0.02
R8799:Sec11a UTSW 7 80935102 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- caccactgcccagctTTATAACATGAT -3'

Sequencing Primer
(F):5'- accttgtctgtttctatctccc -3'
Posted On2014-04-13