Incidental Mutation 'R1511:Rpsa'
ID 168333
Institutional Source Beutler Lab
Gene Symbol Rpsa
Ensembl Gene ENSMUSG00000032518
Gene Name ribosomal protein SA
Synonyms Lamr, P40-8, 67lr, Lamrl1, Lamr1, P40-3
MMRRC Submission 039558-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1511 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 120127689-120132369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120131000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 210 (I210F)
Ref Sequence ENSEMBL: ENSMUSP00000148933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035105] [ENSMUST00000217317] [ENSMUST00000217352] [ENSMUST00000217356]
AlphaFold P14206
Predicted Effect possibly damaging
Transcript: ENSMUST00000035105
AA Change: I210F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035105
Gene: ENSMUSG00000032518
AA Change: I210F

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 18 118 3.7e-12 PFAM
Pfam:Ribosomal_S2 111 184 6.5e-14 PFAM
Pfam:40S_SA_C 202 295 2.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216813
Predicted Effect possibly damaging
Transcript: ENSMUST00000217317
AA Change: I210F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000217352
Predicted Effect probably benign
Transcript: ENSMUST00000217356
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show right ventricular cardiomyocyte degeneration and higher susceptibility to arrhythmia. Homozygous null mice fail to develop past E3.5; heterozygotes show craniofacial defects, low mean corpuscular hemoglobin concentration and reduced insulin content in pancreatic islet cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,514,977 N576K probably benign Het
Abca5 T A 11: 110,299,986 H766L possibly damaging Het
Abca5 G T 11: 110,299,978 L769M probably damaging Het
Acvr1c A G 2: 58,287,884 I191T probably damaging Het
Agps A T 2: 75,866,779 E314D probably damaging Het
Agxt G A 1: 93,135,768 G131R probably damaging Het
Ak8 A G 2: 28,742,746 T326A probably benign Het
Aldoart2 T A 12: 55,566,277 I329N probably benign Het
Apaf1 T C 10: 91,060,185 I342V possibly damaging Het
Arhgap40 T C 2: 158,527,161 S68P probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AU022252 C T 4: 119,228,097 R71Q possibly damaging Het
Baz1b T C 5: 135,217,782 L695P probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Cep76 T C 18: 67,624,958 M421V probably benign Het
Clk2 A G 3: 89,168,703 D60G probably damaging Het
Clstn3 G T 6: 124,462,169 T6K probably damaging Het
Cluap1 T A 16: 3,919,558 D180E probably benign Het
Col12a1 T C 9: 79,699,552 I530V probably benign Het
Cpt1a T C 19: 3,365,788 probably benign Het
Cr2 T G 1: 195,155,272 K797Q possibly damaging Het
Crybg3 C A 16: 59,554,112 V2260L probably benign Het
Csnk1a1 T A 18: 61,585,250 probably benign Het
Cxcr1 T C 1: 74,192,770 D31G probably benign Het
Cyp2a5 G T 7: 26,835,936 D108Y probably damaging Het
Dnajc1 A G 2: 18,222,727 V376A possibly damaging Het
Eif4enif1 T C 11: 3,236,278 V462A probably benign Het
Elmo1 A G 13: 20,290,477 K357R possibly damaging Het
Eml6 T A 11: 29,818,374 H771L probably damaging Het
Epb41l4a A G 18: 33,832,664 I370T probably benign Het
Esp36 A T 17: 38,417,281 N79K possibly damaging Het
Fam229b A G 10: 39,118,919 *81Q probably null Het
Fat4 T C 3: 38,983,076 Y3626H probably damaging Het
Fbn1 A T 2: 125,306,285 F2681Y probably benign Het
Gad1-ps A G 10: 99,445,469 noncoding transcript Het
Galm C A 17: 80,183,267 N284K probably damaging Het
Gtf3c2 A T 5: 31,159,102 S735T probably benign Het
Hsph1 A T 5: 149,630,383 S207T probably benign Het
Il33 C T 19: 29,955,215 R159C probably damaging Het
Invs A G 4: 48,382,148 N106S possibly damaging Het
Kif21b G T 1: 136,169,324 probably null Het
Kirrel2 A G 7: 30,456,498 C42R probably damaging Het
Letm1 A C 5: 33,752,555 C378W probably damaging Het
Lrrc71 T A 3: 87,745,484 K160N probably benign Het
Lrrtm3 A G 10: 64,089,025 I121T probably damaging Het
Lztr1 T A 16: 17,509,670 V79E probably damaging Het
Mmp8 T G 9: 7,566,278 D378E probably damaging Het
Mpzl3 A G 9: 45,066,529 E145G probably damaging Het
Mrps2 C T 2: 28,469,664 L178F probably damaging Het
Mzb1 A G 18: 35,647,822 probably null Het
Nckap1 T C 2: 80,553,415 D135G probably damaging Het
Ndst1 A G 18: 60,697,170 F623L possibly damaging Het
Nlrp5 A T 7: 23,413,347 D143V probably damaging Het
Olfr1225 A G 2: 89,170,937 S92P probably damaging Het
Olfr1241 T C 2: 89,482,248 M296V probably null Het
Olfr1311 A G 2: 112,021,404 V150A probably benign Het
Olfr146 T C 9: 39,019,025 D172G probably benign Het
Olfr307 T C 7: 86,336,345 D17G possibly damaging Het
Olfr32 A G 2: 90,138,404 V245A probably benign Het
Olfr548-ps1 T C 7: 102,542,125 L63P probably damaging Het
Olfr907 A G 9: 38,498,818 I50V probably benign Het
Parp14 T G 16: 35,857,224 E791D probably benign Het
Pcdh8 C T 14: 79,769,389 R578H possibly damaging Het
Phrf1 T A 7: 141,259,801 probably benign Het
Polr3b C A 10: 84,680,385 H626N probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Ppp4r3b T A 11: 29,182,460 V33D probably damaging Het
Ppp5c A G 7: 17,009,982 Y176H probably damaging Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Rabac1 C T 7: 24,972,130 V122M probably damaging Het
Rasef G T 4: 73,735,748 Q561K probably damaging Het
Rbl1 A G 2: 157,195,634 S198P probably damaging Het
Rbm12 A T 2: 156,097,536 M272K probably damaging Het
Rexo1 T G 10: 80,550,050 K391N possibly damaging Het
Rnf43 T C 11: 87,731,347 S384P probably benign Het
Rslcan18 A G 13: 67,098,952 Y75H possibly damaging Het
Scn9a T A 2: 66,526,813 D1048V probably benign Het
Sec11a T C 7: 80,927,734 probably null Het
Sidt2 A G 9: 45,950,089 V19A probably damaging Het
Snx14 G A 9: 88,398,364 Q522* probably null Het
Stx1b A G 7: 127,814,972 L74S probably damaging Het
Tm7sf3 A T 6: 146,609,878 M371K probably benign Het
Tmem115 T C 9: 107,534,975 V166A probably benign Het
Traf5 T A 1: 191,999,951 T310S probably benign Het
Trdn A G 10: 33,466,452 K619E probably benign Het
Trmt10a T A 3: 138,152,184 probably null Het
Txk A C 5: 72,707,671 I287R probably damaging Het
Txndc16 T C 14: 45,151,887 D452G probably damaging Het
Ube2f G A 1: 91,262,301 probably null Het
Ubtfl1 T G 9: 18,410,193 I339R probably benign Het
Upf1 A G 8: 70,338,505 I529T probably damaging Het
Vmn1r197 A G 13: 22,328,653 D248G possibly damaging Het
Vmn1r5 A T 6: 56,985,786 T149S probably benign Het
Vmn1r83 C T 7: 12,321,270 V287I possibly damaging Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vmn2r-ps130 A G 17: 23,063,801 T152A probably benign Het
Vps13b T C 15: 35,839,975 F2448L probably damaging Het
Vps13b A G 15: 35,841,573 N2583S probably benign Het
Wscd1 C T 11: 71,788,675 P458L probably damaging Het
Xylt2 T A 11: 94,670,433 D168V probably damaging Het
Zdhhc2 A G 8: 40,467,972 T306A probably benign Het
Zfp804b A T 5: 6,769,771 D1097E possibly damaging Het
Zfp93 T A 7: 24,275,731 C380* probably null Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Zmynd15 T A 11: 70,464,793 V430E probably damaging Het
Other mutations in Rpsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02503:Rpsa APN 9 120128593 missense possibly damaging 0.57
IGL02522:Rpsa APN 9 120131055 missense possibly damaging 0.47
PIT4515001:Rpsa UTSW 9 120131148 missense probably benign 0.04
R0281:Rpsa UTSW 9 120131003 missense possibly damaging 0.81
R4942:Rpsa UTSW 9 120131063 missense probably benign 0.04
R5814:Rpsa UTSW 9 120128485 start gained probably benign
R6122:Rpsa UTSW 9 120131036 missense probably benign 0.01
R6545:Rpsa UTSW 9 120130257 missense probably benign 0.11
R7225:Rpsa UTSW 9 120131156 missense probably benign 0.00
R8554:Rpsa UTSW 9 120129251 missense possibly damaging 0.80
RF012:Rpsa UTSW 9 120131039 missense probably benign 0.01
Z1176:Rpsa UTSW 9 120130346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCCCAGTGTATTCCTGTACC -3'
(R):5'- TAAAAGCTCCCTGGCAGCCTGATG -3'

Sequencing Primer
(F):5'- AATCTAAGACTTGGGCTGGTGAC -3'
(R):5'- GATGCCCTGGCCTTGATAC -3'
Posted On 2014-04-13