Incidental Mutation 'R1511:Lrrtm3'
ID168336
Institutional Source Beutler Lab
Gene Symbol Lrrtm3
Ensembl Gene ENSMUSG00000042846
Gene Nameleucine rich repeat transmembrane neuronal 3
Synonyms9630044H04Rik
MMRRC Submission 039558-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1511 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63928472-64090277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64089025 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 121 (I121T)
Ref Sequence ENSEMBL: ENSMUSP00000101079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105439] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably benign
Transcript: ENSMUST00000075099
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105439
AA Change: I121T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101079
Gene: ENSMUSG00000042846
AA Change: I121T

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
LRRNT 33 65 2.11e-3 SMART
LRR_TYP 84 107 2.09e-3 SMART
LRR 108 131 6.77e0 SMART
LRR_TYP 132 155 2.71e-2 SMART
LRR_TYP 156 179 1.47e-3 SMART
LRR 180 203 1.43e-1 SMART
LRR 204 227 1.29e1 SMART
LRR 228 251 2.14e1 SMART
LRR 252 276 1.45e1 SMART
LRR 277 300 2.02e-1 SMART
Blast:LRRCT 312 361 6e-16 BLAST
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105440
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105441
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133588
SMART Domains Protein: ENSMUSP00000114794
Gene: ENSMUSG00000042846

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
LRRNT 40 72 2.11e-3 SMART
LRR_TYP 91 114 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148712
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,514,977 N576K probably benign Het
Abca5 G T 11: 110,299,978 L769M probably damaging Het
Abca5 T A 11: 110,299,986 H766L possibly damaging Het
Acvr1c A G 2: 58,287,884 I191T probably damaging Het
Agps A T 2: 75,866,779 E314D probably damaging Het
Agxt G A 1: 93,135,768 G131R probably damaging Het
Ak8 A G 2: 28,742,746 T326A probably benign Het
Aldoart2 T A 12: 55,566,277 I329N probably benign Het
Apaf1 T C 10: 91,060,185 I342V possibly damaging Het
Arhgap40 T C 2: 158,527,161 S68P probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AU022252 C T 4: 119,228,097 R71Q possibly damaging Het
Baz1b T C 5: 135,217,782 L695P probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Cep76 T C 18: 67,624,958 M421V probably benign Het
Clk2 A G 3: 89,168,703 D60G probably damaging Het
Clstn3 G T 6: 124,462,169 T6K probably damaging Het
Cluap1 T A 16: 3,919,558 D180E probably benign Het
Col12a1 T C 9: 79,699,552 I530V probably benign Het
Cpt1a T C 19: 3,365,788 probably benign Het
Cr2 T G 1: 195,155,272 K797Q possibly damaging Het
Crybg3 C A 16: 59,554,112 V2260L probably benign Het
Csnk1a1 T A 18: 61,585,250 probably benign Het
Cxcr1 T C 1: 74,192,770 D31G probably benign Het
Cyp2a5 G T 7: 26,835,936 D108Y probably damaging Het
Dnajc1 A G 2: 18,222,727 V376A possibly damaging Het
Eif4enif1 T C 11: 3,236,278 V462A probably benign Het
Elmo1 A G 13: 20,290,477 K357R possibly damaging Het
Eml6 T A 11: 29,818,374 H771L probably damaging Het
Epb41l4a A G 18: 33,832,664 I370T probably benign Het
Esp36 A T 17: 38,417,281 N79K possibly damaging Het
Fam229b A G 10: 39,118,919 *81Q probably null Het
Fat4 T C 3: 38,983,076 Y3626H probably damaging Het
Fbn1 A T 2: 125,306,285 F2681Y probably benign Het
Gad1-ps A G 10: 99,445,469 noncoding transcript Het
Galm C A 17: 80,183,267 N284K probably damaging Het
Gtf3c2 A T 5: 31,159,102 S735T probably benign Het
Hsph1 A T 5: 149,630,383 S207T probably benign Het
Il33 C T 19: 29,955,215 R159C probably damaging Het
Invs A G 4: 48,382,148 N106S possibly damaging Het
Kif21b G T 1: 136,169,324 probably null Het
Kirrel2 A G 7: 30,456,498 C42R probably damaging Het
Letm1 A C 5: 33,752,555 C378W probably damaging Het
Lrrc71 T A 3: 87,745,484 K160N probably benign Het
Lztr1 T A 16: 17,509,670 V79E probably damaging Het
Mmp8 T G 9: 7,566,278 D378E probably damaging Het
Mpzl3 A G 9: 45,066,529 E145G probably damaging Het
Mrps2 C T 2: 28,469,664 L178F probably damaging Het
Mzb1 A G 18: 35,647,822 probably null Het
Nckap1 T C 2: 80,553,415 D135G probably damaging Het
Ndst1 A G 18: 60,697,170 F623L possibly damaging Het
Nlrp5 A T 7: 23,413,347 D143V probably damaging Het
Olfr1225 A G 2: 89,170,937 S92P probably damaging Het
Olfr1241 T C 2: 89,482,248 M296V probably null Het
Olfr1311 A G 2: 112,021,404 V150A probably benign Het
Olfr146 T C 9: 39,019,025 D172G probably benign Het
Olfr307 T C 7: 86,336,345 D17G possibly damaging Het
Olfr32 A G 2: 90,138,404 V245A probably benign Het
Olfr548-ps1 T C 7: 102,542,125 L63P probably damaging Het
Olfr907 A G 9: 38,498,818 I50V probably benign Het
Parp14 T G 16: 35,857,224 E791D probably benign Het
Pcdh8 C T 14: 79,769,389 R578H possibly damaging Het
Phrf1 T A 7: 141,259,801 probably benign Het
Polr3b C A 10: 84,680,385 H626N probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Ppp4r3b T A 11: 29,182,460 V33D probably damaging Het
Ppp5c A G 7: 17,009,982 Y176H probably damaging Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Rabac1 C T 7: 24,972,130 V122M probably damaging Het
Rasef G T 4: 73,735,748 Q561K probably damaging Het
Rbl1 A G 2: 157,195,634 S198P probably damaging Het
Rbm12 A T 2: 156,097,536 M272K probably damaging Het
Rexo1 T G 10: 80,550,050 K391N possibly damaging Het
Rnf43 T C 11: 87,731,347 S384P probably benign Het
Rpsa A T 9: 120,131,000 I210F possibly damaging Het
Rslcan18 A G 13: 67,098,952 Y75H possibly damaging Het
Scn9a T A 2: 66,526,813 D1048V probably benign Het
Sec11a T C 7: 80,927,734 probably null Het
Sidt2 A G 9: 45,950,089 V19A probably damaging Het
Snx14 G A 9: 88,398,364 Q522* probably null Het
Stx1b A G 7: 127,814,972 L74S probably damaging Het
Tm7sf3 A T 6: 146,609,878 M371K probably benign Het
Tmem115 T C 9: 107,534,975 V166A probably benign Het
Traf5 T A 1: 191,999,951 T310S probably benign Het
Trdn A G 10: 33,466,452 K619E probably benign Het
Trmt10a T A 3: 138,152,184 probably null Het
Txk A C 5: 72,707,671 I287R probably damaging Het
Txndc16 T C 14: 45,151,887 D452G probably damaging Het
Ube2f G A 1: 91,262,301 probably null Het
Ubtfl1 T G 9: 18,410,193 I339R probably benign Het
Upf1 A G 8: 70,338,505 I529T probably damaging Het
Vmn1r197 A G 13: 22,328,653 D248G possibly damaging Het
Vmn1r5 A T 6: 56,985,786 T149S probably benign Het
Vmn1r83 C T 7: 12,321,270 V287I possibly damaging Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vmn2r-ps130 A G 17: 23,063,801 T152A probably benign Het
Vps13b T C 15: 35,839,975 F2448L probably damaging Het
Vps13b A G 15: 35,841,573 N2583S probably benign Het
Wscd1 C T 11: 71,788,675 P458L probably damaging Het
Xylt2 T A 11: 94,670,433 D168V probably damaging Het
Zdhhc2 A G 8: 40,467,972 T306A probably benign Het
Zfp804b A T 5: 6,769,771 D1097E possibly damaging Het
Zfp93 T A 7: 24,275,731 C380* probably null Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Zmynd15 T A 11: 70,464,793 V430E probably damaging Het
Other mutations in Lrrtm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Lrrtm3 APN 10 64089209 missense probably damaging 1.00
IGL02026:Lrrtm3 APN 10 64088452 missense probably damaging 1.00
IGL02452:Lrrtm3 APN 10 64088036 missense probably damaging 0.98
IGL03145:Lrrtm3 APN 10 64089020 missense probably benign 0.00
R1556:Lrrtm3 UTSW 10 64088149 missense probably damaging 0.97
R1921:Lrrtm3 UTSW 10 64088378 missense probably benign 0.37
R1933:Lrrtm3 UTSW 10 64088513 missense possibly damaging 0.81
R2849:Lrrtm3 UTSW 10 64089031 missense probably damaging 1.00
R4707:Lrrtm3 UTSW 10 64088002 missense probably benign 0.42
R4785:Lrrtm3 UTSW 10 64088002 missense probably benign 0.42
R5423:Lrrtm3 UTSW 10 64088152 missense possibly damaging 0.81
R5559:Lrrtm3 UTSW 10 63930266 missense probably benign 0.35
R6295:Lrrtm3 UTSW 10 63930134 missense probably benign
R6301:Lrrtm3 UTSW 10 64089222 missense probably benign 0.26
R6356:Lrrtm3 UTSW 10 63930164 missense probably benign 0.13
R6799:Lrrtm3 UTSW 10 64087851 nonsense probably null
R7419:Lrrtm3 UTSW 10 64088146 missense probably damaging 1.00
R7494:Lrrtm3 UTSW 10 64089179 missense probably damaging 1.00
R7694:Lrrtm3 UTSW 10 64088039 missense probably benign 0.03
R7723:Lrrtm3 UTSW 10 64088648 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGTATCCCAGGTCCAGAAGTTCCAG -3'
(R):5'- AGCACCCACTGTCTTACTGACAATG -3'

Sequencing Primer
(F):5'- TGCGACAGTCTTGGAAGATCC -3'
(R):5'- ACTGTGAGTCTCAGAAACTGC -3'
Posted On2014-04-13