Incidental Mutation 'R1511:Ppp1r12a'
ID 168342
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Name protein phosphatase 1, regulatory subunit 12A
Synonyms 1200015F06Rik, D10Ertd625e, 5730577I22Rik, Mypt1
MMRRC Submission 039558-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1511 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 107997913-108115846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108087720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 58 (T58A)
Ref Sequence ENSEMBL: ENSMUSP00000151478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263] [ENSMUST00000219759]
AlphaFold Q9DBR7
Predicted Effect probably benign
Transcript: ENSMUST00000070663
AA Change: T524A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: T524A

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219068
Predicted Effect probably benign
Transcript: ENSMUST00000219263
AA Change: T524A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219759
AA Change: T58A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,592,041 (GRCm39) N576K probably benign Het
Abca5 G T 11: 110,190,804 (GRCm39) L769M probably damaging Het
Abca5 T A 11: 110,190,812 (GRCm39) H766L possibly damaging Het
Acvr1c A G 2: 58,177,896 (GRCm39) I191T probably damaging Het
Agps A T 2: 75,697,123 (GRCm39) E314D probably damaging Het
Agxt G A 1: 93,063,490 (GRCm39) G131R probably damaging Het
Ak8 A G 2: 28,632,758 (GRCm39) T326A probably benign Het
Aldoart2 T A 12: 55,613,062 (GRCm39) I329N probably benign Het
Apaf1 T C 10: 90,896,047 (GRCm39) I342V possibly damaging Het
Arhgap40 T C 2: 158,369,081 (GRCm39) S68P probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AU022252 C T 4: 119,085,294 (GRCm39) R71Q possibly damaging Het
Baz1b T C 5: 135,246,636 (GRCm39) L695P probably damaging Het
Baz2b A T 2: 59,792,368 (GRCm39) S587T probably benign Het
Cep76 T C 18: 67,758,028 (GRCm39) M421V probably benign Het
Clk2 A G 3: 89,076,010 (GRCm39) D60G probably damaging Het
Clstn3 G T 6: 124,439,128 (GRCm39) T6K probably damaging Het
Cluap1 T A 16: 3,737,422 (GRCm39) D180E probably benign Het
Col12a1 T C 9: 79,606,834 (GRCm39) I530V probably benign Het
Cpt1a T C 19: 3,415,788 (GRCm39) probably benign Het
Cr2 T G 1: 194,837,580 (GRCm39) K797Q possibly damaging Het
Crybg3 C A 16: 59,374,475 (GRCm39) V2260L probably benign Het
Csnk1a1 T A 18: 61,718,321 (GRCm39) probably benign Het
Cxcr1 T C 1: 74,231,929 (GRCm39) D31G probably benign Het
Cyp2a5 G T 7: 26,535,361 (GRCm39) D108Y probably damaging Het
Dnajc1 A G 2: 18,227,538 (GRCm39) V376A possibly damaging Het
Eif4enif1 T C 11: 3,186,278 (GRCm39) V462A probably benign Het
Elmo1 A G 13: 20,474,647 (GRCm39) K357R possibly damaging Het
Eml6 T A 11: 29,768,374 (GRCm39) H771L probably damaging Het
Epb41l4a A G 18: 33,965,717 (GRCm39) I370T probably benign Het
Esp36 A T 17: 38,728,172 (GRCm39) N79K possibly damaging Het
Fam229b A G 10: 38,994,915 (GRCm39) *81Q probably null Het
Fat4 T C 3: 39,037,225 (GRCm39) Y3626H probably damaging Het
Fbn1 A T 2: 125,148,205 (GRCm39) F2681Y probably benign Het
Gad1-ps A G 10: 99,281,331 (GRCm39) noncoding transcript Het
Galm C A 17: 80,490,696 (GRCm39) N284K probably damaging Het
Gtf3c2 A T 5: 31,316,446 (GRCm39) S735T probably benign Het
Hsph1 A T 5: 149,553,848 (GRCm39) S207T probably benign Het
Il33 C T 19: 29,932,615 (GRCm39) R159C probably damaging Het
Invs A G 4: 48,382,148 (GRCm39) N106S possibly damaging Het
Kif21b G T 1: 136,097,062 (GRCm39) probably null Het
Kirrel2 A G 7: 30,155,923 (GRCm39) C42R probably damaging Het
Letm1 A C 5: 33,909,899 (GRCm39) C378W probably damaging Het
Lrrc71 T A 3: 87,652,791 (GRCm39) K160N probably benign Het
Lrrtm3 A G 10: 63,924,804 (GRCm39) I121T probably damaging Het
Lztr1 T A 16: 17,327,534 (GRCm39) V79E probably damaging Het
Mmp8 T G 9: 7,566,279 (GRCm39) D378E probably damaging Het
Mpzl3 A G 9: 44,977,827 (GRCm39) E145G probably damaging Het
Mrps2 C T 2: 28,359,676 (GRCm39) L178F probably damaging Het
Mzb1 A G 18: 35,780,875 (GRCm39) probably null Het
Nckap1 T C 2: 80,383,759 (GRCm39) D135G probably damaging Het
Ndst1 A G 18: 60,830,242 (GRCm39) F623L possibly damaging Het
Nlrp5 A T 7: 23,112,772 (GRCm39) D143V probably damaging Het
Or14a260 T C 7: 85,985,553 (GRCm39) D17G possibly damaging Het
Or4a69 T C 2: 89,312,592 (GRCm39) M296V probably null Het
Or4b1d A G 2: 89,968,748 (GRCm39) V245A probably benign Het
Or4c120 A G 2: 89,001,281 (GRCm39) S92P probably damaging Het
Or4f58 A G 2: 111,851,749 (GRCm39) V150A probably benign Het
Or52b4i T C 7: 102,191,332 (GRCm39) L63P probably damaging Het
Or8b44 A G 9: 38,410,114 (GRCm39) I50V probably benign Het
Or8g17 T C 9: 38,930,321 (GRCm39) D172G probably benign Het
Parp14 T G 16: 35,677,594 (GRCm39) E791D probably benign Het
Pcdh8 C T 14: 80,006,829 (GRCm39) R578H possibly damaging Het
Phrf1 T A 7: 140,839,714 (GRCm39) probably benign Het
Polr3b C A 10: 84,516,249 (GRCm39) H626N probably benign Het
Ppp4r3b T A 11: 29,132,460 (GRCm39) V33D probably damaging Het
Ppp5c A G 7: 16,743,907 (GRCm39) Y176H probably damaging Het
R3hdm1 A G 1: 128,124,742 (GRCm39) Y343C probably damaging Het
Rabac1 C T 7: 24,671,555 (GRCm39) V122M probably damaging Het
Rasef G T 4: 73,653,985 (GRCm39) Q561K probably damaging Het
Rbl1 A G 2: 157,037,554 (GRCm39) S198P probably damaging Het
Rbm12 A T 2: 155,939,456 (GRCm39) M272K probably damaging Het
Rexo1 T G 10: 80,385,884 (GRCm39) K391N possibly damaging Het
Rnf43 T C 11: 87,622,173 (GRCm39) S384P probably benign Het
Rpsa A T 9: 119,960,066 (GRCm39) I210F possibly damaging Het
Rslcan18 A G 13: 67,247,016 (GRCm39) Y75H possibly damaging Het
Scn9a T A 2: 66,357,157 (GRCm39) D1048V probably benign Het
Sec11a T C 7: 80,577,482 (GRCm39) probably null Het
Sidt2 A G 9: 45,861,387 (GRCm39) V19A probably damaging Het
Snx14 G A 9: 88,280,417 (GRCm39) Q522* probably null Het
Stx1b A G 7: 127,414,144 (GRCm39) L74S probably damaging Het
Tm7sf3 A T 6: 146,511,376 (GRCm39) M371K probably benign Het
Tmem115 T C 9: 107,412,174 (GRCm39) V166A probably benign Het
Traf5 T A 1: 191,731,912 (GRCm39) T310S probably benign Het
Trdn A G 10: 33,342,448 (GRCm39) K619E probably benign Het
Trmt10a T A 3: 137,857,945 (GRCm39) probably null Het
Txk A C 5: 72,865,014 (GRCm39) I287R probably damaging Het
Txndc16 T C 14: 45,389,344 (GRCm39) D452G probably damaging Het
Ube2f G A 1: 91,190,023 (GRCm39) probably null Het
Ubtfl1 T G 9: 18,321,489 (GRCm39) I339R probably benign Het
Upf1 A G 8: 70,791,155 (GRCm39) I529T probably damaging Het
Vmn1r197 A G 13: 22,512,823 (GRCm39) D248G possibly damaging Het
Vmn1r5 A T 6: 56,962,771 (GRCm39) T149S probably benign Het
Vmn1r83 C T 7: 12,055,197 (GRCm39) V287I possibly damaging Het
Vmn2r118 G A 17: 55,915,496 (GRCm39) R485* probably null Het
Vmn2r130 A G 17: 23,282,775 (GRCm39) T152A probably benign Het
Vps13b T C 15: 35,840,121 (GRCm39) F2448L probably damaging Het
Vps13b A G 15: 35,841,719 (GRCm39) N2583S probably benign Het
Wscd1 C T 11: 71,679,501 (GRCm39) P458L probably damaging Het
Xylt2 T A 11: 94,561,259 (GRCm39) D168V probably damaging Het
Zdhhc2 A G 8: 40,921,013 (GRCm39) T306A probably benign Het
Zfp804b A T 5: 6,819,771 (GRCm39) D1097E possibly damaging Het
Zfp93 T A 7: 23,975,156 (GRCm39) C380* probably null Het
Zfp960 T A 17: 17,308,518 (GRCm39) C411S probably damaging Het
Zmynd15 T A 11: 70,355,619 (GRCm39) V430E probably damaging Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108,034,709 (GRCm39) missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108,066,334 (GRCm39) missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108,076,682 (GRCm39) missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108,069,882 (GRCm39) missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108,105,185 (GRCm39) missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108,034,779 (GRCm39) missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108,097,115 (GRCm39) missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108,097,106 (GRCm39) missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108,089,193 (GRCm39) missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108,109,242 (GRCm39) intron probably benign
R0826:Ppp1r12a UTSW 10 108,066,414 (GRCm39) missense possibly damaging 0.46
R0839:Ppp1r12a UTSW 10 108,034,722 (GRCm39) missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108,087,720 (GRCm39) missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108,098,212 (GRCm39) missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108,034,779 (GRCm39) missense probably damaging 0.98
R1376:Ppp1r12a UTSW 10 108,034,779 (GRCm39) missense probably damaging 0.98
R1616:Ppp1r12a UTSW 10 108,096,728 (GRCm39) missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108,085,426 (GRCm39) missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108,098,292 (GRCm39) missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108,034,752 (GRCm39) missense probably damaging 1.00
R1902:Ppp1r12a UTSW 10 108,034,752 (GRCm39) missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108,034,780 (GRCm39) missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108,034,780 (GRCm39) missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108,100,595 (GRCm39) missense probably damaging 1.00
R3856:Ppp1r12a UTSW 10 108,089,362 (GRCm39) intron probably benign
R3973:Ppp1r12a UTSW 10 108,089,341 (GRCm39) missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108,089,341 (GRCm39) missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108,089,341 (GRCm39) missense probably benign 0.44
R4502:Ppp1r12a UTSW 10 108,085,339 (GRCm39) missense probably benign 0.26
R4902:Ppp1r12a UTSW 10 108,066,451 (GRCm39) missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108,103,263 (GRCm39) critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108,096,886 (GRCm39) missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108,097,077 (GRCm39) splice site probably null
R5428:Ppp1r12a UTSW 10 108,089,208 (GRCm39) missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108,075,973 (GRCm39) missense probably damaging 1.00
R5510:Ppp1r12a UTSW 10 108,085,488 (GRCm39) missense possibly damaging 0.82
R6217:Ppp1r12a UTSW 10 108,076,045 (GRCm39) splice site probably null
R6274:Ppp1r12a UTSW 10 108,096,751 (GRCm39) missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108,098,281 (GRCm39) missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108,066,395 (GRCm39) missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108,097,137 (GRCm39) missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108,098,242 (GRCm39) nonsense probably null
R6993:Ppp1r12a UTSW 10 108,076,698 (GRCm39) missense probably benign 0.18
R7565:Ppp1r12a UTSW 10 108,104,501 (GRCm39) missense probably benign 0.21
R8153:Ppp1r12a UTSW 10 107,998,303 (GRCm39) missense probably damaging 0.98
R8174:Ppp1r12a UTSW 10 108,107,598 (GRCm39) missense probably benign 0.26
R8407:Ppp1r12a UTSW 10 108,076,042 (GRCm39) critical splice donor site probably null
R8422:Ppp1r12a UTSW 10 108,077,042 (GRCm39) missense probably benign
R8716:Ppp1r12a UTSW 10 108,096,749 (GRCm39) missense probably damaging 1.00
R9090:Ppp1r12a UTSW 10 108,098,224 (GRCm39) missense probably damaging 1.00
R9179:Ppp1r12a UTSW 10 108,087,782 (GRCm39) missense probably damaging 1.00
R9271:Ppp1r12a UTSW 10 108,098,224 (GRCm39) missense probably damaging 1.00
R9396:Ppp1r12a UTSW 10 108,100,571 (GRCm39) missense probably damaging 1.00
R9683:Ppp1r12a UTSW 10 108,096,747 (GRCm39) missense possibly damaging 0.78
X0027:Ppp1r12a UTSW 10 108,050,284 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAACACTGCATGGTCACTGTCTG -3'
(R):5'- TGCTTTCCACAAAGAAGTAGAACTCTCC -3'

Sequencing Primer
(F):5'- ggggtgtttttggttttgttttg -3'
(R):5'- CATAGCTGAGTTGTAGTCCAAAC -3'
Posted On 2014-04-13