Incidental Mutation 'R1511:Elmo1'
ID 168354
Institutional Source Beutler Lab
Gene Symbol Elmo1
Ensembl Gene ENSMUSG00000041112
Gene Name engulfment and cell motility 1
Synonyms C230095H21Rik, 6330578D22Rik, CED-12
MMRRC Submission 039558-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1511 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 20090596-20608353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20290477 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 357 (K357R)
Ref Sequence ENSEMBL: ENSMUSP00000152595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072519] [ENSMUST00000180626]
AlphaFold Q8BPU7
Predicted Effect possibly damaging
Transcript: ENSMUST00000072519
AA Change: K357R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072334
Gene: ENSMUSG00000041112
AA Change: K357R

DomainStartEndE-ValueType
Pfam:DUF3361 115 280 3.8e-64 PFAM
Pfam:ELMO_CED12 303 481 2.8e-42 PFAM
PH 555 676 2.32e0 SMART
low complexity region 704 717 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180626
AA Change: K357R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220751
Predicted Effect unknown
Transcript: ENSMUST00000221595
AA Change: K136R
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,514,977 N576K probably benign Het
Abca5 T A 11: 110,299,986 H766L possibly damaging Het
Abca5 G T 11: 110,299,978 L769M probably damaging Het
Acvr1c A G 2: 58,287,884 I191T probably damaging Het
Agps A T 2: 75,866,779 E314D probably damaging Het
Agxt G A 1: 93,135,768 G131R probably damaging Het
Ak8 A G 2: 28,742,746 T326A probably benign Het
Aldoart2 T A 12: 55,566,277 I329N probably benign Het
Apaf1 T C 10: 91,060,185 I342V possibly damaging Het
Arhgap40 T C 2: 158,527,161 S68P probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AU022252 C T 4: 119,228,097 R71Q possibly damaging Het
Baz1b T C 5: 135,217,782 L695P probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Cep76 T C 18: 67,624,958 M421V probably benign Het
Clk2 A G 3: 89,168,703 D60G probably damaging Het
Clstn3 G T 6: 124,462,169 T6K probably damaging Het
Cluap1 T A 16: 3,919,558 D180E probably benign Het
Col12a1 T C 9: 79,699,552 I530V probably benign Het
Cpt1a T C 19: 3,365,788 probably benign Het
Cr2 T G 1: 195,155,272 K797Q possibly damaging Het
Crybg3 C A 16: 59,554,112 V2260L probably benign Het
Csnk1a1 T A 18: 61,585,250 probably benign Het
Cxcr1 T C 1: 74,192,770 D31G probably benign Het
Cyp2a5 G T 7: 26,835,936 D108Y probably damaging Het
Dnajc1 A G 2: 18,222,727 V376A possibly damaging Het
Eif4enif1 T C 11: 3,236,278 V462A probably benign Het
Eml6 T A 11: 29,818,374 H771L probably damaging Het
Epb41l4a A G 18: 33,832,664 I370T probably benign Het
Esp36 A T 17: 38,417,281 N79K possibly damaging Het
Fam229b A G 10: 39,118,919 *81Q probably null Het
Fat4 T C 3: 38,983,076 Y3626H probably damaging Het
Fbn1 A T 2: 125,306,285 F2681Y probably benign Het
Gad1-ps A G 10: 99,445,469 noncoding transcript Het
Galm C A 17: 80,183,267 N284K probably damaging Het
Gtf3c2 A T 5: 31,159,102 S735T probably benign Het
Hsph1 A T 5: 149,630,383 S207T probably benign Het
Il33 C T 19: 29,955,215 R159C probably damaging Het
Invs A G 4: 48,382,148 N106S possibly damaging Het
Kif21b G T 1: 136,169,324 probably null Het
Kirrel2 A G 7: 30,456,498 C42R probably damaging Het
Letm1 A C 5: 33,752,555 C378W probably damaging Het
Lrrc71 T A 3: 87,745,484 K160N probably benign Het
Lrrtm3 A G 10: 64,089,025 I121T probably damaging Het
Lztr1 T A 16: 17,509,670 V79E probably damaging Het
Mmp8 T G 9: 7,566,278 D378E probably damaging Het
Mpzl3 A G 9: 45,066,529 E145G probably damaging Het
Mrps2 C T 2: 28,469,664 L178F probably damaging Het
Mzb1 A G 18: 35,647,822 probably null Het
Nckap1 T C 2: 80,553,415 D135G probably damaging Het
Ndst1 A G 18: 60,697,170 F623L possibly damaging Het
Nlrp5 A T 7: 23,413,347 D143V probably damaging Het
Olfr1225 A G 2: 89,170,937 S92P probably damaging Het
Olfr1241 T C 2: 89,482,248 M296V probably null Het
Olfr1311 A G 2: 112,021,404 V150A probably benign Het
Olfr146 T C 9: 39,019,025 D172G probably benign Het
Olfr307 T C 7: 86,336,345 D17G possibly damaging Het
Olfr32 A G 2: 90,138,404 V245A probably benign Het
Olfr548-ps1 T C 7: 102,542,125 L63P probably damaging Het
Olfr907 A G 9: 38,498,818 I50V probably benign Het
Parp14 T G 16: 35,857,224 E791D probably benign Het
Pcdh8 C T 14: 79,769,389 R578H possibly damaging Het
Phrf1 T A 7: 141,259,801 probably benign Het
Polr3b C A 10: 84,680,385 H626N probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Ppp4r3b T A 11: 29,182,460 V33D probably damaging Het
Ppp5c A G 7: 17,009,982 Y176H probably damaging Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Rabac1 C T 7: 24,972,130 V122M probably damaging Het
Rasef G T 4: 73,735,748 Q561K probably damaging Het
Rbl1 A G 2: 157,195,634 S198P probably damaging Het
Rbm12 A T 2: 156,097,536 M272K probably damaging Het
Rexo1 T G 10: 80,550,050 K391N possibly damaging Het
Rnf43 T C 11: 87,731,347 S384P probably benign Het
Rpsa A T 9: 120,131,000 I210F possibly damaging Het
Rslcan18 A G 13: 67,098,952 Y75H possibly damaging Het
Scn9a T A 2: 66,526,813 D1048V probably benign Het
Sec11a T C 7: 80,927,734 probably null Het
Sidt2 A G 9: 45,950,089 V19A probably damaging Het
Snx14 G A 9: 88,398,364 Q522* probably null Het
Stx1b A G 7: 127,814,972 L74S probably damaging Het
Tm7sf3 A T 6: 146,609,878 M371K probably benign Het
Tmem115 T C 9: 107,534,975 V166A probably benign Het
Traf5 T A 1: 191,999,951 T310S probably benign Het
Trdn A G 10: 33,466,452 K619E probably benign Het
Trmt10a T A 3: 138,152,184 probably null Het
Txk A C 5: 72,707,671 I287R probably damaging Het
Txndc16 T C 14: 45,151,887 D452G probably damaging Het
Ube2f G A 1: 91,262,301 probably null Het
Ubtfl1 T G 9: 18,410,193 I339R probably benign Het
Upf1 A G 8: 70,338,505 I529T probably damaging Het
Vmn1r197 A G 13: 22,328,653 D248G possibly damaging Het
Vmn1r5 A T 6: 56,985,786 T149S probably benign Het
Vmn1r83 C T 7: 12,321,270 V287I possibly damaging Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vmn2r-ps130 A G 17: 23,063,801 T152A probably benign Het
Vps13b A G 15: 35,841,573 N2583S probably benign Het
Vps13b T C 15: 35,839,975 F2448L probably damaging Het
Wscd1 C T 11: 71,788,675 P458L probably damaging Het
Xylt2 T A 11: 94,670,433 D168V probably damaging Het
Zdhhc2 A G 8: 40,467,972 T306A probably benign Het
Zfp804b A T 5: 6,769,771 D1097E possibly damaging Het
Zfp93 T A 7: 24,275,731 C380* probably null Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Zmynd15 T A 11: 70,464,793 V430E probably damaging Het
Other mutations in Elmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Elmo1 APN 13 20261579 missense probably benign
IGL00814:Elmo1 APN 13 20286724 missense probably damaging 0.97
IGL00849:Elmo1 APN 13 20582323 nonsense probably null
IGL01417:Elmo1 APN 13 20251175 critical splice donor site probably null
IGL01994:Elmo1 APN 13 20342464 missense probably damaging 0.99
IGL02435:Elmo1 APN 13 20589656 missense probably damaging 1.00
IGL02605:Elmo1 APN 13 20605202 missense probably damaging 1.00
IGL02716:Elmo1 APN 13 20449502 missense probably damaging 0.98
IGL03389:Elmo1 APN 13 20342426 missense probably damaging 0.98
braveheart UTSW 13 20274621 critical splice donor site probably benign
Debil UTSW 13 20373161 missense probably damaging 1.00
Dollie UTSW 13 20572446 missense possibly damaging 0.91
Edinburg UTSW 13 20290383 nonsense probably null
glasgow UTSW 13 20589642 critical splice acceptor site probably null
Golly UTSW 13 20373116 missense possibly damaging 0.96
Lockerbie UTSW 13 20600201 missense probably damaging 1.00
sesame UTSW 13 20600212 nonsense probably null
Tickle UTSW 13 20280803 splice site probably null
Wilmut UTSW 13 20582268 nonsense probably null
Writhe UTSW 13 20600259 critical splice donor site probably null
H8562:Elmo1 UTSW 13 20280863 missense probably damaging 1.00
R0360:Elmo1 UTSW 13 20564493 nonsense probably null
R0364:Elmo1 UTSW 13 20564493 nonsense probably null
R0372:Elmo1 UTSW 13 20572459 critical splice donor site probably null
R0975:Elmo1 UTSW 13 20251137 missense probably damaging 0.98
R1167:Elmo1 UTSW 13 20185455 missense probably damaging 1.00
R1671:Elmo1 UTSW 13 20287884 splice site probably benign
R1677:Elmo1 UTSW 13 20589671 missense probably benign 0.22
R1868:Elmo1 UTSW 13 20589653 missense possibly damaging 0.78
R2941:Elmo1 UTSW 13 20600212 nonsense probably null
R3508:Elmo1 UTSW 13 20605232 missense probably damaging 1.00
R4344:Elmo1 UTSW 13 20261552 splice site probably null
R4378:Elmo1 UTSW 13 20373116 missense possibly damaging 0.96
R4423:Elmo1 UTSW 13 20600212 nonsense probably null
R4425:Elmo1 UTSW 13 20600212 nonsense probably null
R4516:Elmo1 UTSW 13 20282914 missense probably benign 0.11
R4862:Elmo1 UTSW 13 20449512 missense probably benign
R4990:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4991:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4992:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R5197:Elmo1 UTSW 13 20564437 missense probably benign 0.20
R5269:Elmo1 UTSW 13 20449486 missense probably benign 0.00
R5386:Elmo1 UTSW 13 20600210 missense probably benign 0.01
R5471:Elmo1 UTSW 13 20572385 missense probably benign 0.01
R5922:Elmo1 UTSW 13 20605169 missense probably damaging 1.00
R5947:Elmo1 UTSW 13 20290383 nonsense probably null
R6512:Elmo1 UTSW 13 20373161 missense probably damaging 1.00
R6531:Elmo1 UTSW 13 20572446 missense possibly damaging 0.91
R7338:Elmo1 UTSW 13 20280812 missense probably benign 0.37
R7378:Elmo1 UTSW 13 20280935 missense probably benign 0.00
R7477:Elmo1 UTSW 13 20285319 missense
R7593:Elmo1 UTSW 13 20290440 missense probably benign
R7721:Elmo1 UTSW 13 20280803 splice site probably null
R7778:Elmo1 UTSW 13 20589642 critical splice acceptor site probably null
R8001:Elmo1 UTSW 13 20286732 missense probably benign 0.05
R8133:Elmo1 UTSW 13 20373086 missense probably damaging 1.00
R8248:Elmo1 UTSW 13 20600201 missense probably damaging 1.00
R8685:Elmo1 UTSW 13 20290424 missense possibly damaging 0.61
R8713:Elmo1 UTSW 13 20274621 critical splice donor site probably benign
R8888:Elmo1 UTSW 13 20564460 missense probably damaging 1.00
R8895:Elmo1 UTSW 13 20564460 missense probably damaging 1.00
R8945:Elmo1 UTSW 13 20582268 nonsense probably null
R9292:Elmo1 UTSW 13 20600259 critical splice donor site probably null
R9389:Elmo1 UTSW 13 20185491 missense probably benign 0.01
R9417:Elmo1 UTSW 13 20572403 missense possibly damaging 0.57
R9472:Elmo1 UTSW 13 20286727 missense probably benign 0.31
R9622:Elmo1 UTSW 13 20208140 missense probably benign 0.01
R9661:Elmo1 UTSW 13 20285361 critical splice donor site probably null
RF008:Elmo1 UTSW 13 20274536 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTGTCATGCACAGTGAAAGCAGC -3'
(R):5'- TGTCACCATTCATCCCACCAGGAG -3'

Sequencing Primer
(F):5'- GCAGCTTGCTTTCTTTTTGCC -3'
(R):5'- AGAACCACAGTGGCTTTCG -3'
Posted On 2014-04-13