Incidental Mutation 'R1511:Lztr1'
ID 168362
Institutional Source Beutler Lab
Gene Symbol Lztr1
Ensembl Gene ENSMUSG00000022761
Gene Name leucine-zipper-like transcriptional regulator, 1
Synonyms TCFL2, 1200003E21Rik
MMRRC Submission 039558-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1511 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 17326552-17344197 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 17327534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 79 (V79E)
Ref Sequence ENSEMBL: ENSMUSP00000156071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000023448] [ENSMUST00000115681] [ENSMUST00000115685] [ENSMUST00000231292] [ENSMUST00000231994] [ENSMUST00000232242] [ENSMUST00000232372]
AlphaFold Q9CQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000023444
AA Change: V79E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761
AA Change: V79E

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023448
SMART Domains Protein: ENSMUSP00000023448
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 3.6e-18 PFAM
Pfam:Rieske_2 70 166 7.7e-11 PFAM
Pfam:Pyr_redox_2 196 473 1.1e-34 PFAM
Pfam:Pyr_redox 334 416 7e-17 PFAM
Pfam:Reductase_C 512 591 9.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115681
AA Change: V79E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111345
Gene: ENSMUSG00000022761
AA Change: V79E

DomainStartEndE-ValueType
Pfam:Kelch_5 63 99 1.1e-6 PFAM
Pfam:Kelch_1 64 105 1.6e-8 PFAM
Pfam:Kelch_4 64 113 5.8e-9 PFAM
Pfam:Kelch_6 64 115 2.6e-9 PFAM
Pfam:Kelch_3 74 123 2.4e-11 PFAM
Pfam:Kelch_5 111 150 5.5e-10 PFAM
Pfam:Kelch_1 114 161 5.8e-8 PFAM
Pfam:Kelch_2 114 163 3.1e-8 PFAM
Pfam:Kelch_4 114 170 1e-9 PFAM
Pfam:Kelch_3 124 180 2.5e-10 PFAM
Pfam:Kelch_5 168 204 6.1e-7 PFAM
Pfam:Kelch_4 171 224 7.9e-8 PFAM
Pfam:Kelch_3 181 233 9.1e-8 PFAM
Pfam:Kelch_4 223 279 3.1e-7 PFAM
Pfam:Kelch_1 224 267 1.9e-6 PFAM
Pfam:Kelch_3 234 289 1.5e-8 PFAM
Pfam:Kelch_1 280 325 2.9e-10 PFAM
Pfam:Kelch_2 280 325 1.3e-7 PFAM
Pfam:Kelch_6 280 326 2.4e-9 PFAM
Pfam:Kelch_4 280 335 1.7e-9 PFAM
Pfam:Kelch_5 381 419 2.8e-7 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 797 1.7e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115685
SMART Domains Protein: ENSMUSP00000111349
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 6.5e-23 PFAM
Pfam:Rieske_2 70 166 1.4e-10 PFAM
Pfam:Pyr_redox_2 195 493 1.6e-65 PFAM
Pfam:Pyr_redox 334 416 7.3e-18 PFAM
Pfam:Reductase_C 512 586 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149234
Predicted Effect probably damaging
Transcript: ENSMUST00000231292
AA Change: V79E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231994
AA Change: V79E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231508
Predicted Effect probably benign
Transcript: ENSMUST00000232242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232644
Predicted Effect probably benign
Transcript: ENSMUST00000232372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231538
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the BR-C, ttk and bab-kelch superfamily that, in humans, localizes to the Golgi network and is associated with the ras / mitogen-activated protein kinase pathway. Loss-of-function mutations in the human ortholog are associated with glioblastoma multiforme, schwannomatosis, Noonan syndrome, and DiGeorge syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,592,041 (GRCm39) N576K probably benign Het
Abca5 G T 11: 110,190,804 (GRCm39) L769M probably damaging Het
Abca5 T A 11: 110,190,812 (GRCm39) H766L possibly damaging Het
Acvr1c A G 2: 58,177,896 (GRCm39) I191T probably damaging Het
Agps A T 2: 75,697,123 (GRCm39) E314D probably damaging Het
Agxt G A 1: 93,063,490 (GRCm39) G131R probably damaging Het
Ak8 A G 2: 28,632,758 (GRCm39) T326A probably benign Het
Aldoart2 T A 12: 55,613,062 (GRCm39) I329N probably benign Het
Apaf1 T C 10: 90,896,047 (GRCm39) I342V possibly damaging Het
Arhgap40 T C 2: 158,369,081 (GRCm39) S68P probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AU022252 C T 4: 119,085,294 (GRCm39) R71Q possibly damaging Het
Baz1b T C 5: 135,246,636 (GRCm39) L695P probably damaging Het
Baz2b A T 2: 59,792,368 (GRCm39) S587T probably benign Het
Cep76 T C 18: 67,758,028 (GRCm39) M421V probably benign Het
Clk2 A G 3: 89,076,010 (GRCm39) D60G probably damaging Het
Clstn3 G T 6: 124,439,128 (GRCm39) T6K probably damaging Het
Cluap1 T A 16: 3,737,422 (GRCm39) D180E probably benign Het
Col12a1 T C 9: 79,606,834 (GRCm39) I530V probably benign Het
Cpt1a T C 19: 3,415,788 (GRCm39) probably benign Het
Cr2 T G 1: 194,837,580 (GRCm39) K797Q possibly damaging Het
Crybg3 C A 16: 59,374,475 (GRCm39) V2260L probably benign Het
Csnk1a1 T A 18: 61,718,321 (GRCm39) probably benign Het
Cxcr1 T C 1: 74,231,929 (GRCm39) D31G probably benign Het
Cyp2a5 G T 7: 26,535,361 (GRCm39) D108Y probably damaging Het
Dnajc1 A G 2: 18,227,538 (GRCm39) V376A possibly damaging Het
Eif4enif1 T C 11: 3,186,278 (GRCm39) V462A probably benign Het
Elmo1 A G 13: 20,474,647 (GRCm39) K357R possibly damaging Het
Eml6 T A 11: 29,768,374 (GRCm39) H771L probably damaging Het
Epb41l4a A G 18: 33,965,717 (GRCm39) I370T probably benign Het
Esp36 A T 17: 38,728,172 (GRCm39) N79K possibly damaging Het
Fam229b A G 10: 38,994,915 (GRCm39) *81Q probably null Het
Fat4 T C 3: 39,037,225 (GRCm39) Y3626H probably damaging Het
Fbn1 A T 2: 125,148,205 (GRCm39) F2681Y probably benign Het
Gad1-ps A G 10: 99,281,331 (GRCm39) noncoding transcript Het
Galm C A 17: 80,490,696 (GRCm39) N284K probably damaging Het
Gtf3c2 A T 5: 31,316,446 (GRCm39) S735T probably benign Het
Hsph1 A T 5: 149,553,848 (GRCm39) S207T probably benign Het
Il33 C T 19: 29,932,615 (GRCm39) R159C probably damaging Het
Invs A G 4: 48,382,148 (GRCm39) N106S possibly damaging Het
Kif21b G T 1: 136,097,062 (GRCm39) probably null Het
Kirrel2 A G 7: 30,155,923 (GRCm39) C42R probably damaging Het
Letm1 A C 5: 33,909,899 (GRCm39) C378W probably damaging Het
Lrrc71 T A 3: 87,652,791 (GRCm39) K160N probably benign Het
Lrrtm3 A G 10: 63,924,804 (GRCm39) I121T probably damaging Het
Mmp8 T G 9: 7,566,279 (GRCm39) D378E probably damaging Het
Mpzl3 A G 9: 44,977,827 (GRCm39) E145G probably damaging Het
Mrps2 C T 2: 28,359,676 (GRCm39) L178F probably damaging Het
Mzb1 A G 18: 35,780,875 (GRCm39) probably null Het
Nckap1 T C 2: 80,383,759 (GRCm39) D135G probably damaging Het
Ndst1 A G 18: 60,830,242 (GRCm39) F623L possibly damaging Het
Nlrp5 A T 7: 23,112,772 (GRCm39) D143V probably damaging Het
Or14a260 T C 7: 85,985,553 (GRCm39) D17G possibly damaging Het
Or4a69 T C 2: 89,312,592 (GRCm39) M296V probably null Het
Or4b1d A G 2: 89,968,748 (GRCm39) V245A probably benign Het
Or4c120 A G 2: 89,001,281 (GRCm39) S92P probably damaging Het
Or4f58 A G 2: 111,851,749 (GRCm39) V150A probably benign Het
Or52b4i T C 7: 102,191,332 (GRCm39) L63P probably damaging Het
Or8b44 A G 9: 38,410,114 (GRCm39) I50V probably benign Het
Or8g17 T C 9: 38,930,321 (GRCm39) D172G probably benign Het
Parp14 T G 16: 35,677,594 (GRCm39) E791D probably benign Het
Pcdh8 C T 14: 80,006,829 (GRCm39) R578H possibly damaging Het
Phrf1 T A 7: 140,839,714 (GRCm39) probably benign Het
Polr3b C A 10: 84,516,249 (GRCm39) H626N probably benign Het
Ppp1r12a A G 10: 108,087,720 (GRCm39) T58A probably benign Het
Ppp4r3b T A 11: 29,132,460 (GRCm39) V33D probably damaging Het
Ppp5c A G 7: 16,743,907 (GRCm39) Y176H probably damaging Het
R3hdm1 A G 1: 128,124,742 (GRCm39) Y343C probably damaging Het
Rabac1 C T 7: 24,671,555 (GRCm39) V122M probably damaging Het
Rasef G T 4: 73,653,985 (GRCm39) Q561K probably damaging Het
Rbl1 A G 2: 157,037,554 (GRCm39) S198P probably damaging Het
Rbm12 A T 2: 155,939,456 (GRCm39) M272K probably damaging Het
Rexo1 T G 10: 80,385,884 (GRCm39) K391N possibly damaging Het
Rnf43 T C 11: 87,622,173 (GRCm39) S384P probably benign Het
Rpsa A T 9: 119,960,066 (GRCm39) I210F possibly damaging Het
Rslcan18 A G 13: 67,247,016 (GRCm39) Y75H possibly damaging Het
Scn9a T A 2: 66,357,157 (GRCm39) D1048V probably benign Het
Sec11a T C 7: 80,577,482 (GRCm39) probably null Het
Sidt2 A G 9: 45,861,387 (GRCm39) V19A probably damaging Het
Snx14 G A 9: 88,280,417 (GRCm39) Q522* probably null Het
Stx1b A G 7: 127,414,144 (GRCm39) L74S probably damaging Het
Tm7sf3 A T 6: 146,511,376 (GRCm39) M371K probably benign Het
Tmem115 T C 9: 107,412,174 (GRCm39) V166A probably benign Het
Traf5 T A 1: 191,731,912 (GRCm39) T310S probably benign Het
Trdn A G 10: 33,342,448 (GRCm39) K619E probably benign Het
Trmt10a T A 3: 137,857,945 (GRCm39) probably null Het
Txk A C 5: 72,865,014 (GRCm39) I287R probably damaging Het
Txndc16 T C 14: 45,389,344 (GRCm39) D452G probably damaging Het
Ube2f G A 1: 91,190,023 (GRCm39) probably null Het
Ubtfl1 T G 9: 18,321,489 (GRCm39) I339R probably benign Het
Upf1 A G 8: 70,791,155 (GRCm39) I529T probably damaging Het
Vmn1r197 A G 13: 22,512,823 (GRCm39) D248G possibly damaging Het
Vmn1r5 A T 6: 56,962,771 (GRCm39) T149S probably benign Het
Vmn1r83 C T 7: 12,055,197 (GRCm39) V287I possibly damaging Het
Vmn2r118 G A 17: 55,915,496 (GRCm39) R485* probably null Het
Vmn2r130 A G 17: 23,282,775 (GRCm39) T152A probably benign Het
Vps13b T C 15: 35,840,121 (GRCm39) F2448L probably damaging Het
Vps13b A G 15: 35,841,719 (GRCm39) N2583S probably benign Het
Wscd1 C T 11: 71,679,501 (GRCm39) P458L probably damaging Het
Xylt2 T A 11: 94,561,259 (GRCm39) D168V probably damaging Het
Zdhhc2 A G 8: 40,921,013 (GRCm39) T306A probably benign Het
Zfp804b A T 5: 6,819,771 (GRCm39) D1097E possibly damaging Het
Zfp93 T A 7: 23,975,156 (GRCm39) C380* probably null Het
Zfp960 T A 17: 17,308,518 (GRCm39) C411S probably damaging Het
Zmynd15 T A 11: 70,355,619 (GRCm39) V430E probably damaging Het
Other mutations in Lztr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lztr1 APN 16 17,335,314 (GRCm39) splice site probably benign
IGL01152:Lztr1 APN 16 17,340,317 (GRCm39) missense probably damaging 1.00
IGL01501:Lztr1 APN 16 17,340,255 (GRCm39) splice site probably null
IGL01512:Lztr1 APN 16 17,340,255 (GRCm39) splice site probably null
IGL01514:Lztr1 APN 16 17,340,255 (GRCm39) splice site probably null
IGL01516:Lztr1 APN 16 17,340,255 (GRCm39) splice site probably null
IGL01933:Lztr1 APN 16 17,338,455 (GRCm39) missense probably damaging 1.00
IGL02603:Lztr1 APN 16 17,327,550 (GRCm39) missense possibly damaging 0.77
IGL03012:Lztr1 APN 16 17,339,348 (GRCm39) missense possibly damaging 0.92
IGL03191:Lztr1 APN 16 17,336,392 (GRCm39) missense probably damaging 1.00
R0331:Lztr1 UTSW 16 17,342,101 (GRCm39) unclassified probably benign
R0717:Lztr1 UTSW 16 17,333,912 (GRCm39) splice site probably null
R1925:Lztr1 UTSW 16 17,341,247 (GRCm39) missense probably damaging 1.00
R2062:Lztr1 UTSW 16 17,327,534 (GRCm39) missense probably damaging 1.00
R3694:Lztr1 UTSW 16 17,326,925 (GRCm39) missense possibly damaging 0.90
R3935:Lztr1 UTSW 16 17,340,059 (GRCm39) nonsense probably null
R4645:Lztr1 UTSW 16 17,341,955 (GRCm39) unclassified probably benign
R5624:Lztr1 UTSW 16 17,329,993 (GRCm39) splice site probably benign
R7175:Lztr1 UTSW 16 17,340,895 (GRCm39) missense possibly damaging 0.84
R7222:Lztr1 UTSW 16 17,341,996 (GRCm39) missense possibly damaging 0.86
R7420:Lztr1 UTSW 16 17,341,993 (GRCm39) missense probably damaging 1.00
R7515:Lztr1 UTSW 16 17,327,525 (GRCm39) missense possibly damaging 0.87
R7516:Lztr1 UTSW 16 17,327,525 (GRCm39) missense possibly damaging 0.87
R8027:Lztr1 UTSW 16 17,329,976 (GRCm39) missense probably damaging 1.00
R8153:Lztr1 UTSW 16 17,336,439 (GRCm39) critical splice donor site probably null
R8836:Lztr1 UTSW 16 17,343,402 (GRCm39) missense probably benign 0.07
R8965:Lztr1 UTSW 16 17,327,296 (GRCm39) critical splice donor site probably null
R9015:Lztr1 UTSW 16 17,337,305 (GRCm39) missense probably benign 0.08
R9232:Lztr1 UTSW 16 17,339,343 (GRCm39) missense possibly damaging 0.78
R9667:Lztr1 UTSW 16 17,327,000 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGAGTGGGAAGTCTGAAGCGTC -3'
(R):5'- CTCACCGTAACATGGGAATCAAGGG -3'

Sequencing Primer
(F):5'- CCTTGCTGTCTGAAGAACTGAAG -3'
(R):5'- GAATCAAGGGCAAAGCACC -3'
Posted On 2014-04-13