Incidental Mutation 'R1511:Lztr1'
ID168362
Institutional Source Beutler Lab
Gene Symbol Lztr1
Ensembl Gene ENSMUSG00000022761
Gene Nameleucine-zipper-like transcriptional regulator, 1
Synonyms1200003E21Rik, TCFL2
MMRRC Submission 039558-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1511 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17508688-17526333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17509670 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 79 (V79E)
Ref Sequence ENSEMBL: ENSMUSP00000156071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000023448] [ENSMUST00000115681] [ENSMUST00000115685] [ENSMUST00000231292] [ENSMUST00000231994] [ENSMUST00000232242] [ENSMUST00000232372]
Predicted Effect probably damaging
Transcript: ENSMUST00000023444
AA Change: V79E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761
AA Change: V79E

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023448
SMART Domains Protein: ENSMUSP00000023448
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 3.6e-18 PFAM
Pfam:Rieske_2 70 166 7.7e-11 PFAM
Pfam:Pyr_redox_2 196 473 1.1e-34 PFAM
Pfam:Pyr_redox 334 416 7e-17 PFAM
Pfam:Reductase_C 512 591 9.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115681
AA Change: V79E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111345
Gene: ENSMUSG00000022761
AA Change: V79E

DomainStartEndE-ValueType
Pfam:Kelch_5 63 99 1.1e-6 PFAM
Pfam:Kelch_1 64 105 1.6e-8 PFAM
Pfam:Kelch_4 64 113 5.8e-9 PFAM
Pfam:Kelch_6 64 115 2.6e-9 PFAM
Pfam:Kelch_3 74 123 2.4e-11 PFAM
Pfam:Kelch_5 111 150 5.5e-10 PFAM
Pfam:Kelch_1 114 161 5.8e-8 PFAM
Pfam:Kelch_2 114 163 3.1e-8 PFAM
Pfam:Kelch_4 114 170 1e-9 PFAM
Pfam:Kelch_3 124 180 2.5e-10 PFAM
Pfam:Kelch_5 168 204 6.1e-7 PFAM
Pfam:Kelch_4 171 224 7.9e-8 PFAM
Pfam:Kelch_3 181 233 9.1e-8 PFAM
Pfam:Kelch_4 223 279 3.1e-7 PFAM
Pfam:Kelch_1 224 267 1.9e-6 PFAM
Pfam:Kelch_3 234 289 1.5e-8 PFAM
Pfam:Kelch_1 280 325 2.9e-10 PFAM
Pfam:Kelch_2 280 325 1.3e-7 PFAM
Pfam:Kelch_6 280 326 2.4e-9 PFAM
Pfam:Kelch_4 280 335 1.7e-9 PFAM
Pfam:Kelch_5 381 419 2.8e-7 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 797 1.7e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115685
SMART Domains Protein: ENSMUSP00000111349
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 6.5e-23 PFAM
Pfam:Rieske_2 70 166 1.4e-10 PFAM
Pfam:Pyr_redox_2 195 493 1.6e-65 PFAM
Pfam:Pyr_redox 334 416 7.3e-18 PFAM
Pfam:Reductase_C 512 586 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152077
Predicted Effect probably damaging
Transcript: ENSMUST00000231292
AA Change: V79E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231508
Predicted Effect probably damaging
Transcript: ENSMUST00000231994
AA Change: V79E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232379
Predicted Effect probably benign
Transcript: ENSMUST00000232242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232644
Predicted Effect probably benign
Transcript: ENSMUST00000232372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231538
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the BR-C, ttk and bab-kelch superfamily that, in humans, localizes to the Golgi network and is associated with the ras / mitogen-activated protein kinase pathway. Loss-of-function mutations in the human ortholog are associated with glioblastoma multiforme, schwannomatosis, Noonan syndrome, and DiGeorge syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,514,977 N576K probably benign Het
Abca5 G T 11: 110,299,978 L769M probably damaging Het
Abca5 T A 11: 110,299,986 H766L possibly damaging Het
Acvr1c A G 2: 58,287,884 I191T probably damaging Het
Agps A T 2: 75,866,779 E314D probably damaging Het
Agxt G A 1: 93,135,768 G131R probably damaging Het
Ak8 A G 2: 28,742,746 T326A probably benign Het
Aldoart2 T A 12: 55,566,277 I329N probably benign Het
Apaf1 T C 10: 91,060,185 I342V possibly damaging Het
Arhgap40 T C 2: 158,527,161 S68P probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AU022252 C T 4: 119,228,097 R71Q possibly damaging Het
Baz1b T C 5: 135,217,782 L695P probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Cep76 T C 18: 67,624,958 M421V probably benign Het
Clk2 A G 3: 89,168,703 D60G probably damaging Het
Clstn3 G T 6: 124,462,169 T6K probably damaging Het
Cluap1 T A 16: 3,919,558 D180E probably benign Het
Col12a1 T C 9: 79,699,552 I530V probably benign Het
Cpt1a T C 19: 3,365,788 probably benign Het
Cr2 T G 1: 195,155,272 K797Q possibly damaging Het
Crybg3 C A 16: 59,554,112 V2260L probably benign Het
Csnk1a1 T A 18: 61,585,250 probably benign Het
Cxcr1 T C 1: 74,192,770 D31G probably benign Het
Cyp2a5 G T 7: 26,835,936 D108Y probably damaging Het
Dnajc1 A G 2: 18,222,727 V376A possibly damaging Het
Eif4enif1 T C 11: 3,236,278 V462A probably benign Het
Elmo1 A G 13: 20,290,477 K357R possibly damaging Het
Eml6 T A 11: 29,818,374 H771L probably damaging Het
Epb41l4a A G 18: 33,832,664 I370T probably benign Het
Esp36 A T 17: 38,417,281 N79K possibly damaging Het
Fam229b A G 10: 39,118,919 *81Q probably null Het
Fat4 T C 3: 38,983,076 Y3626H probably damaging Het
Fbn1 A T 2: 125,306,285 F2681Y probably benign Het
Gad1-ps A G 10: 99,445,469 noncoding transcript Het
Galm C A 17: 80,183,267 N284K probably damaging Het
Gtf3c2 A T 5: 31,159,102 S735T probably benign Het
Hsph1 A T 5: 149,630,383 S207T probably benign Het
Il33 C T 19: 29,955,215 R159C probably damaging Het
Invs A G 4: 48,382,148 N106S possibly damaging Het
Kif21b G T 1: 136,169,324 probably null Het
Kirrel2 A G 7: 30,456,498 C42R probably damaging Het
Letm1 A C 5: 33,752,555 C378W probably damaging Het
Lrrc71 T A 3: 87,745,484 K160N probably benign Het
Lrrtm3 A G 10: 64,089,025 I121T probably damaging Het
Mmp8 T G 9: 7,566,278 D378E probably damaging Het
Mpzl3 A G 9: 45,066,529 E145G probably damaging Het
Mrps2 C T 2: 28,469,664 L178F probably damaging Het
Mzb1 A G 18: 35,647,822 probably null Het
Nckap1 T C 2: 80,553,415 D135G probably damaging Het
Ndst1 A G 18: 60,697,170 F623L possibly damaging Het
Nlrp5 A T 7: 23,413,347 D143V probably damaging Het
Olfr1225 A G 2: 89,170,937 S92P probably damaging Het
Olfr1241 T C 2: 89,482,248 M296V probably null Het
Olfr1311 A G 2: 112,021,404 V150A probably benign Het
Olfr146 T C 9: 39,019,025 D172G probably benign Het
Olfr307 T C 7: 86,336,345 D17G possibly damaging Het
Olfr32 A G 2: 90,138,404 V245A probably benign Het
Olfr548-ps1 T C 7: 102,542,125 L63P probably damaging Het
Olfr907 A G 9: 38,498,818 I50V probably benign Het
Parp14 T G 16: 35,857,224 E791D probably benign Het
Pcdh8 C T 14: 79,769,389 R578H possibly damaging Het
Phrf1 T A 7: 141,259,801 probably benign Het
Polr3b C A 10: 84,680,385 H626N probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Ppp4r3b T A 11: 29,182,460 V33D probably damaging Het
Ppp5c A G 7: 17,009,982 Y176H probably damaging Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Rabac1 C T 7: 24,972,130 V122M probably damaging Het
Rasef G T 4: 73,735,748 Q561K probably damaging Het
Rbl1 A G 2: 157,195,634 S198P probably damaging Het
Rbm12 A T 2: 156,097,536 M272K probably damaging Het
Rexo1 T G 10: 80,550,050 K391N possibly damaging Het
Rnf43 T C 11: 87,731,347 S384P probably benign Het
Rpsa A T 9: 120,131,000 I210F possibly damaging Het
Rslcan18 A G 13: 67,098,952 Y75H possibly damaging Het
Scn9a T A 2: 66,526,813 D1048V probably benign Het
Sec11a T C 7: 80,927,734 probably null Het
Sidt2 A G 9: 45,950,089 V19A probably damaging Het
Snx14 G A 9: 88,398,364 Q522* probably null Het
Stx1b A G 7: 127,814,972 L74S probably damaging Het
Tm7sf3 A T 6: 146,609,878 M371K probably benign Het
Tmem115 T C 9: 107,534,975 V166A probably benign Het
Traf5 T A 1: 191,999,951 T310S probably benign Het
Trdn A G 10: 33,466,452 K619E probably benign Het
Trmt10a T A 3: 138,152,184 probably null Het
Txk A C 5: 72,707,671 I287R probably damaging Het
Txndc16 T C 14: 45,151,887 D452G probably damaging Het
Ube2f G A 1: 91,262,301 probably null Het
Ubtfl1 T G 9: 18,410,193 I339R probably benign Het
Upf1 A G 8: 70,338,505 I529T probably damaging Het
Vmn1r197 A G 13: 22,328,653 D248G possibly damaging Het
Vmn1r5 A T 6: 56,985,786 T149S probably benign Het
Vmn1r83 C T 7: 12,321,270 V287I possibly damaging Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vmn2r-ps130 A G 17: 23,063,801 T152A probably benign Het
Vps13b T C 15: 35,839,975 F2448L probably damaging Het
Vps13b A G 15: 35,841,573 N2583S probably benign Het
Wscd1 C T 11: 71,788,675 P458L probably damaging Het
Xylt2 T A 11: 94,670,433 D168V probably damaging Het
Zdhhc2 A G 8: 40,467,972 T306A probably benign Het
Zfp804b A T 5: 6,769,771 D1097E possibly damaging Het
Zfp93 T A 7: 24,275,731 C380* probably null Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Zmynd15 T A 11: 70,464,793 V430E probably damaging Het
Other mutations in Lztr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lztr1 APN 16 17517450 splice site probably benign
IGL01152:Lztr1 APN 16 17522453 missense probably damaging 1.00
IGL01501:Lztr1 APN 16 17522391 splice site probably null
IGL01512:Lztr1 APN 16 17522391 splice site probably null
IGL01514:Lztr1 APN 16 17522391 splice site probably null
IGL01516:Lztr1 APN 16 17522391 splice site probably null
IGL01933:Lztr1 APN 16 17520591 missense probably damaging 1.00
IGL02603:Lztr1 APN 16 17509686 missense possibly damaging 0.77
IGL03012:Lztr1 APN 16 17521484 missense possibly damaging 0.92
IGL03191:Lztr1 APN 16 17518528 missense probably damaging 1.00
R0331:Lztr1 UTSW 16 17524237 unclassified probably benign
R0717:Lztr1 UTSW 16 17516048 splice site probably null
R1925:Lztr1 UTSW 16 17523383 missense probably damaging 1.00
R2062:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R3694:Lztr1 UTSW 16 17509061 missense possibly damaging 0.90
R3935:Lztr1 UTSW 16 17522195 nonsense probably null
R4645:Lztr1 UTSW 16 17524091 unclassified probably benign
R5624:Lztr1 UTSW 16 17512129 splice site probably benign
R7175:Lztr1 UTSW 16 17523031 missense possibly damaging 0.84
R7222:Lztr1 UTSW 16 17524132 missense possibly damaging 0.86
R7420:Lztr1 UTSW 16 17524129 missense probably damaging 1.00
R7515:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R7516:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R8027:Lztr1 UTSW 16 17512112 missense probably damaging 1.00
R8153:Lztr1 UTSW 16 17518575 critical splice donor site probably null
R8836:Lztr1 UTSW 16 17525538 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTATGAGTGGGAAGTCTGAAGCGTC -3'
(R):5'- CTCACCGTAACATGGGAATCAAGGG -3'

Sequencing Primer
(F):5'- CCTTGCTGTCTGAAGAACTGAAG -3'
(R):5'- GAATCAAGGGCAAAGCACC -3'
Posted On2014-04-13