Incidental Mutation 'R1512:Aox1'
ID 168380
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Name aldehyde oxidase 1
Synonyms Aox-1, retinal oxidase, Aox-2, Aox2
MMRRC Submission 039559-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1512 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 58069090-58145572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58346510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 548 (D548G)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: D548G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: D548G

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161126
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,086,295 (GRCm39) D40E probably benign Het
Acsf2 C T 11: 94,452,224 (GRCm39) probably benign Het
Adamts19 C T 18: 59,181,917 (GRCm39) H1119Y possibly damaging Het
Akap6 A G 12: 52,983,937 (GRCm39) D827G probably damaging Het
Ankrd33b T C 15: 31,367,375 (GRCm39) D55G probably damaging Het
Ano5 T A 7: 51,229,316 (GRCm39) H569Q probably benign Het
Baz2a A G 10: 127,960,021 (GRCm39) D1433G possibly damaging Het
BC031181 T G 18: 75,141,767 (GRCm39) V8G probably damaging Het
Bicdl2 A T 17: 23,887,083 (GRCm39) M457L probably damaging Het
C130074G19Rik T C 1: 184,615,103 (GRCm39) D29G probably damaging Het
Cd200r1 A T 16: 44,586,390 (GRCm39) T7S probably benign Het
Cdc37 A G 9: 21,053,712 (GRCm39) probably benign Het
Cmtr2 T C 8: 110,949,267 (GRCm39) S526P probably damaging Het
Cntn2 G T 1: 132,451,430 (GRCm39) A433D probably damaging Het
Cntnap5a T C 1: 115,828,680 (GRCm39) S35P probably benign Het
Csf3r A G 4: 125,923,777 (GRCm39) T96A possibly damaging Het
Ctbs A G 3: 146,160,720 (GRCm39) N96D probably benign Het
Cyp26b1 C A 6: 84,553,979 (GRCm39) V213L probably benign Het
Dach1 A G 14: 98,138,835 (GRCm39) L536P probably damaging Het
Dcaf6 T C 1: 165,179,589 (GRCm39) Q517R probably benign Het
Dnah1 G T 14: 31,014,994 (GRCm39) Q1733K probably damaging Het
Dnah17 A T 11: 117,985,841 (GRCm39) I1416N probably benign Het
Dock11 G A X: 35,283,688 (GRCm39) R1102H probably damaging Het
Dpp8 T C 9: 64,971,096 (GRCm39) probably benign Het
Emc1 G A 4: 139,087,495 (GRCm39) probably null Het
Emc8 A G 8: 121,384,983 (GRCm39) L76P possibly damaging Het
Emx2 T C 19: 59,448,035 (GRCm39) Y130H possibly damaging Het
Fbf1 C T 11: 116,038,753 (GRCm39) R815Q probably damaging Het
Foxb2 G A 19: 16,849,878 (GRCm39) P376L probably damaging Het
Gabrb1 C A 5: 72,266,047 (GRCm39) L202I probably damaging Het
Gabrb1 T A 5: 72,266,048 (GRCm39) L202Q probably damaging Het
Grin2c T A 11: 115,144,676 (GRCm39) I617F probably damaging Het
Gtf2h3 T A 5: 124,728,933 (GRCm39) V164E probably damaging Het
Gusb T C 5: 130,029,731 (GRCm39) Q88R probably damaging Het
Hormad2 T A 11: 4,374,788 (GRCm39) K75N probably damaging Het
Il33 A G 19: 29,929,390 (GRCm39) T38A possibly damaging Het
Ivns1abp A T 1: 151,236,687 (GRCm39) Q416L possibly damaging Het
Ivns1abp G C 1: 151,236,688 (GRCm39) Q416H probably benign Het
Kcnh5 T A 12: 75,166,711 (GRCm39) H178L probably benign Het
Kif21b A G 1: 136,080,543 (GRCm39) N579S probably benign Het
Kif26a G C 12: 112,113,389 (GRCm39) R95P possibly damaging Het
Kl A G 5: 150,912,062 (GRCm39) I604V probably benign Het
Klhl24 A G 16: 19,941,686 (GRCm39) K545E probably damaging Het
Mcm3ap A G 10: 76,306,347 (GRCm39) I153M probably damaging Het
Meis1 T G 11: 18,831,682 (GRCm39) D452A probably damaging Het
Msantd4 C T 9: 4,384,138 (GRCm39) P153L probably benign Het
Myot A G 18: 44,475,422 (GRCm39) E181G probably damaging Het
Nf1 T C 11: 79,281,195 (GRCm39) F150S probably damaging Het
Nyap2 T A 1: 81,219,566 (GRCm39) S529R probably damaging Het
Or10d3 T C 9: 39,461,390 (GRCm39) Y259C probably damaging Het
Or12e10 A T 2: 87,640,988 (GRCm39) T275S probably benign Het
Or2y1c A G 11: 49,361,286 (GRCm39) I103V probably benign Het
Or8b56 T A 9: 38,739,660 (GRCm39) Y224* probably null Het
Pcnt C T 10: 76,240,496 (GRCm39) probably null Het
Pik3c3 T C 18: 30,455,289 (GRCm39) probably null Het
Pkdcc A T 17: 83,527,473 (GRCm39) Y217F possibly damaging Het
Pnpla6 C A 8: 3,585,459 (GRCm39) probably benign Het
Polr3gl T C 3: 96,488,190 (GRCm39) M26V probably benign Het
Ppp1r13b T C 12: 111,838,842 (GRCm39) N12S possibly damaging Het
Ppp1r26 G A 2: 28,341,528 (GRCm39) R386K probably benign Het
Prdm10 A G 9: 31,248,697 (GRCm39) E355G probably damaging Het
Prex2 T C 1: 11,131,554 (GRCm39) F41S possibly damaging Het
Prkar1b G T 5: 139,036,428 (GRCm39) Y231* probably null Het
Prkdc A T 16: 15,505,268 (GRCm39) I857L probably benign Het
Psg21 A T 7: 18,390,425 (GRCm39) N10K probably benign Het
Rapgef3 A T 15: 97,655,382 (GRCm39) V444E probably benign Het
Rnf17 A T 14: 56,705,243 (GRCm39) T716S probably benign Het
Rps6ka1 C T 4: 133,578,315 (GRCm39) R577H probably damaging Het
Scn1a A C 2: 66,161,629 (GRCm39) N306K possibly damaging Het
Skint6 A G 4: 113,095,329 (GRCm39) I110T probably damaging Het
Ssu2 A G 6: 112,364,959 (GRCm39) M1T probably null Het
Stag3 A T 5: 138,296,247 (GRCm39) T437S probably benign Het
Tal2 A G 4: 53,786,107 (GRCm39) Y96C probably benign Het
Thoc3 A T 13: 54,613,991 (GRCm39) probably null Het
Tle1 T C 4: 72,059,495 (GRCm39) D19G probably damaging Het
Trpm4 A G 7: 44,964,468 (GRCm39) I690T probably benign Het
Trpm6 A T 19: 18,853,295 (GRCm39) M1772L probably benign Het
Unc5b G A 10: 60,667,254 (GRCm39) probably benign Het
Usf3 G T 16: 44,041,561 (GRCm39) V2014F probably damaging Het
Utp18 C T 11: 93,776,390 (GRCm39) A32T probably benign Het
Wdfy4 A G 14: 32,682,765 (GRCm39) V2981A probably damaging Het
Zfp608 A G 18: 55,079,738 (GRCm39) V349A probably damaging Het
Znfx1 A C 2: 166,898,237 (GRCm39) I229S probably benign Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58,098,203 (GRCm39) missense probably damaging 1.00
IGL01014:Aox1 APN 1 58,361,960 (GRCm39) missense possibly damaging 0.73
IGL01077:Aox1 APN 1 58,096,569 (GRCm39) splice site probably benign
IGL01288:Aox1 APN 1 58,333,566 (GRCm39) missense probably damaging 0.99
IGL01335:Aox1 APN 1 58,121,312 (GRCm39) nonsense probably null
IGL01383:Aox1 APN 1 58,333,464 (GRCm39) missense probably benign 0.09
IGL01410:Aox1 APN 1 58,145,184 (GRCm39) splice site probably null
IGL01684:Aox1 APN 1 58,116,740 (GRCm39) splice site probably null
IGL01727:Aox1 APN 1 58,112,387 (GRCm39) nonsense probably null
IGL01734:Aox1 APN 1 58,393,469 (GRCm39) missense possibly damaging 0.95
IGL01793:Aox1 APN 1 58,375,783 (GRCm39) missense possibly damaging 0.79
IGL01805:Aox1 APN 1 58,120,672 (GRCm39) missense possibly damaging 0.94
IGL01834:Aox1 APN 1 58,348,183 (GRCm39) missense possibly damaging 0.90
IGL01924:Aox1 APN 1 58,326,902 (GRCm39) missense possibly damaging 0.90
IGL01996:Aox1 APN 1 58,121,225 (GRCm39) missense probably benign 0.11
IGL02060:Aox1 APN 1 58,137,114 (GRCm39) missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58,104,499 (GRCm39) missense probably benign 0.00
IGL02591:Aox1 APN 1 58,398,158 (GRCm39) nonsense probably null
IGL02645:Aox1 APN 1 58,373,883 (GRCm39) missense probably damaging 1.00
IGL02710:Aox1 APN 1 58,373,928 (GRCm39) critical splice donor site probably null
IGL02801:Aox1 APN 1 58,393,336 (GRCm39) missense probably damaging 1.00
IGL02839:Aox1 APN 1 58,107,943 (GRCm39) missense probably benign 0.05
IGL02975:Aox1 APN 1 58,107,550 (GRCm39) missense probably damaging 1.00
IGL02988:Aox1 APN 1 58,376,509 (GRCm39) missense probably benign
IGL03062:Aox1 APN 1 58,117,624 (GRCm39) missense probably benign 0.01
IGL03104:Aox1 APN 1 58,321,918 (GRCm39) missense probably benign
IGL03121:Aox1 APN 1 58,398,113 (GRCm39) missense probably damaging 1.00
IGL03191:Aox1 APN 1 58,398,228 (GRCm39) missense probably null 0.98
IGL03236:Aox1 APN 1 58,349,156 (GRCm39) nonsense probably null
IGL03286:Aox1 APN 1 58,088,543 (GRCm39) missense probably benign 0.19
IGL03335:Aox1 APN 1 58,115,319 (GRCm39) missense probably damaging 0.98
IGL03395:Aox1 APN 1 58,107,884 (GRCm39) splice site probably benign
IGL03409:Aox1 APN 1 58,393,588 (GRCm39) missense possibly damaging 0.91
PIT4362001:Aox1 UTSW 1 58,321,839 (GRCm39) missense probably damaging 1.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0048:Aox1 UTSW 1 58,112,371 (GRCm39) missense probably damaging 0.98
R0144:Aox1 UTSW 1 58,109,233 (GRCm39) missense probably benign 0.00
R0207:Aox1 UTSW 1 58,144,173 (GRCm39) missense possibly damaging 0.82
R0267:Aox1 UTSW 1 58,378,605 (GRCm39) splice site probably benign
R0357:Aox1 UTSW 1 58,131,675 (GRCm39) missense probably damaging 1.00
R0383:Aox1 UTSW 1 58,100,400 (GRCm39) missense probably benign 0.00
R0388:Aox1 UTSW 1 58,393,565 (GRCm39) missense probably damaging 1.00
R0399:Aox1 UTSW 1 58,108,008 (GRCm39) splice site probably null
R0409:Aox1 UTSW 1 58,375,783 (GRCm39) missense possibly damaging 0.90
R0465:Aox1 UTSW 1 58,101,366 (GRCm39) missense probably damaging 1.00
R0480:Aox1 UTSW 1 58,082,810 (GRCm39) splice site probably benign
R0547:Aox1 UTSW 1 58,349,201 (GRCm39) missense probably damaging 0.96
R0630:Aox1 UTSW 1 58,376,480 (GRCm39) splice site probably benign
R0726:Aox1 UTSW 1 58,373,941 (GRCm39) splice site probably benign
R0734:Aox1 UTSW 1 58,344,500 (GRCm39) missense probably benign 0.22
R0831:Aox1 UTSW 1 58,378,842 (GRCm39) missense probably benign 0.28
R0961:Aox1 UTSW 1 58,349,230 (GRCm39) missense probably benign 0.00
R1005:Aox1 UTSW 1 58,104,511 (GRCm39) missense probably benign 0.00
R1404:Aox1 UTSW 1 58,385,371 (GRCm39) splice site probably benign
R1507:Aox1 UTSW 1 58,143,610 (GRCm39) missense probably benign 0.01
R1573:Aox1 UTSW 1 58,348,186 (GRCm39) missense probably benign 0.00
R1592:Aox1 UTSW 1 58,339,853 (GRCm39) missense probably benign 0.00
R1597:Aox1 UTSW 1 58,086,326 (GRCm39) missense probably damaging 1.00
R1693:Aox1 UTSW 1 58,124,701 (GRCm39) missense probably damaging 1.00
R1709:Aox1 UTSW 1 58,116,633 (GRCm39) missense probably benign
R1747:Aox1 UTSW 1 58,378,751 (GRCm39) missense probably benign 0.01
R1768:Aox1 UTSW 1 58,393,354 (GRCm39) missense probably benign 0.00
R1809:Aox1 UTSW 1 58,333,484 (GRCm39) missense probably benign
R1823:Aox1 UTSW 1 58,351,518 (GRCm39) missense probably benign 0.02
R1834:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1835:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1836:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1869:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1870:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1898:Aox1 UTSW 1 58,117,601 (GRCm39) missense probably damaging 1.00
R1908:Aox1 UTSW 1 58,141,783 (GRCm39) missense probably damaging 1.00
R2002:Aox1 UTSW 1 58,086,300 (GRCm39) missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2065:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2219:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2220:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2265:Aox1 UTSW 1 58,120,679 (GRCm39) missense probably damaging 0.99
R2508:Aox1 UTSW 1 58,382,832 (GRCm39) missense probably benign 0.38
R2942:Aox1 UTSW 1 58,376,540 (GRCm39) missense probably benign 0.03
R2967:Aox1 UTSW 1 58,361,993 (GRCm39) missense probably damaging 0.96
R3082:Aox1 UTSW 1 58,322,759 (GRCm39) splice site probably benign
R3161:Aox1 UTSW 1 58,343,597 (GRCm39) missense possibly damaging 0.91
R3408:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R3713:Aox1 UTSW 1 58,095,374 (GRCm39) missense probably benign 0.01
R3778:Aox1 UTSW 1 58,092,862 (GRCm39) missense possibly damaging 0.89
R3803:Aox1 UTSW 1 58,329,058 (GRCm39) splice site probably null
R3894:Aox1 UTSW 1 58,373,837 (GRCm39) critical splice acceptor site probably null
R4198:Aox1 UTSW 1 58,124,766 (GRCm39) missense probably benign
R4214:Aox1 UTSW 1 58,346,603 (GRCm39) critical splice donor site probably null
R4249:Aox1 UTSW 1 58,338,978 (GRCm39) missense probably benign 0.01
R4296:Aox1 UTSW 1 58,096,559 (GRCm39) splice site probably null
R4562:Aox1 UTSW 1 58,098,215 (GRCm39) missense probably damaging 0.99
R4666:Aox1 UTSW 1 58,343,756 (GRCm39) nonsense probably null
R4668:Aox1 UTSW 1 58,373,853 (GRCm39) missense possibly damaging 0.63
R4703:Aox1 UTSW 1 58,398,116 (GRCm39) missense possibly damaging 0.78
R4758:Aox1 UTSW 1 58,371,741 (GRCm39) missense probably benign 0.00
R4858:Aox1 UTSW 1 58,143,640 (GRCm39) missense probably benign
R4862:Aox1 UTSW 1 58,134,316 (GRCm39) missense probably damaging 0.98
R4890:Aox1 UTSW 1 58,373,862 (GRCm39) missense probably benign 0.11
R4900:Aox1 UTSW 1 58,344,544 (GRCm39) missense probably benign
R4924:Aox1 UTSW 1 58,344,503 (GRCm39) missense probably damaging 1.00
R4970:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5048:Aox1 UTSW 1 58,098,641 (GRCm39) splice site probably benign
R5112:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5127:Aox1 UTSW 1 58,069,185 (GRCm39) missense probably benign 0.00
R5139:Aox1 UTSW 1 58,100,456 (GRCm39) missense probably benign 0.03
R5157:Aox1 UTSW 1 58,109,222 (GRCm39) missense probably damaging 1.00
R5168:Aox1 UTSW 1 58,088,561 (GRCm39) missense probably damaging 1.00
R5186:Aox1 UTSW 1 58,107,529 (GRCm39) missense probably damaging 1.00
R5235:Aox1 UTSW 1 58,096,714 (GRCm39) missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58,131,717 (GRCm39) missense probably damaging 0.99
R5466:Aox1 UTSW 1 58,080,619 (GRCm39) missense probably damaging 1.00
R5540:Aox1 UTSW 1 58,143,569 (GRCm39) missense probably benign 0.03
R5615:Aox1 UTSW 1 58,136,125 (GRCm39) missense probably benign
R5652:Aox1 UTSW 1 58,134,356 (GRCm39) missense probably damaging 1.00
R5920:Aox1 UTSW 1 58,088,631 (GRCm39) missense probably damaging 1.00
R5987:Aox1 UTSW 1 58,346,518 (GRCm39) missense probably benign 0.00
R6008:Aox1 UTSW 1 58,116,672 (GRCm39) missense probably damaging 1.00
R6073:Aox1 UTSW 1 58,143,668 (GRCm39) critical splice donor site probably null
R6215:Aox1 UTSW 1 58,124,620 (GRCm39) missense probably benign
R6239:Aox1 UTSW 1 58,344,550 (GRCm39) critical splice donor site probably null
R6273:Aox1 UTSW 1 58,378,831 (GRCm39) missense probably benign 0.00
R6291:Aox1 UTSW 1 58,369,965 (GRCm39) missense probably damaging 0.98
R6334:Aox1 UTSW 1 58,346,566 (GRCm39) nonsense probably null
R6403:Aox1 UTSW 1 58,107,594 (GRCm39) missense probably damaging 1.00
R6440:Aox1 UTSW 1 58,133,631 (GRCm39) missense probably damaging 1.00
R6601:Aox1 UTSW 1 58,102,665 (GRCm39) missense probably damaging 1.00
R6608:Aox1 UTSW 1 58,096,705 (GRCm39) missense probably benign 0.40
R6752:Aox1 UTSW 1 58,086,398 (GRCm39) missense probably benign 0.00
R6764:Aox1 UTSW 1 58,389,441 (GRCm39) missense probably damaging 0.97
R6766:Aox1 UTSW 1 58,388,227 (GRCm39) missense possibly damaging 0.95
R6789:Aox1 UTSW 1 58,343,644 (GRCm39) missense probably benign 0.01
R6804:Aox1 UTSW 1 58,343,757 (GRCm39) missense probably benign 0.04
R6989:Aox1 UTSW 1 58,124,611 (GRCm39) missense probably damaging 1.00
R7007:Aox1 UTSW 1 58,370,051 (GRCm39) missense probably damaging 1.00
R7015:Aox1 UTSW 1 58,321,917 (GRCm39) missense probably benign 0.00
R7042:Aox1 UTSW 1 58,141,759 (GRCm39) missense probably damaging 0.99
R7055:Aox1 UTSW 1 58,338,927 (GRCm39) missense probably benign 0.08
R7089:Aox1 UTSW 1 58,375,808 (GRCm39) missense probably benign 0.01
R7157:Aox1 UTSW 1 58,322,651 (GRCm39) missense probably benign 0.00
R7303:Aox1 UTSW 1 58,373,924 (GRCm39) nonsense probably null
R7426:Aox1 UTSW 1 58,329,142 (GRCm39) nonsense probably null
R7442:Aox1 UTSW 1 58,121,172 (GRCm39) missense probably damaging 1.00
R7506:Aox1 UTSW 1 58,088,562 (GRCm39) missense probably damaging 1.00
R7563:Aox1 UTSW 1 58,086,304 (GRCm39) missense probably benign 0.32
R7589:Aox1 UTSW 1 58,080,643 (GRCm39) missense probably damaging 1.00
R7735:Aox1 UTSW 1 58,107,451 (GRCm39) missense probably benign 0.01
R7762:Aox1 UTSW 1 58,388,263 (GRCm39) missense probably damaging 1.00
R7814:Aox1 UTSW 1 58,124,626 (GRCm39) missense probably benign
R7876:Aox1 UTSW 1 58,101,330 (GRCm39) nonsense probably null
R7899:Aox1 UTSW 1 58,320,396 (GRCm39) splice site probably null
R7905:Aox1 UTSW 1 58,143,557 (GRCm39) missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R7942:Aox1 UTSW 1 58,376,590 (GRCm39) missense probably damaging 1.00
R7975:Aox1 UTSW 1 58,348,187 (GRCm39) missense probably benign 0.02
R8029:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R8032:Aox1 UTSW 1 58,389,442 (GRCm39) missense probably benign 0.01
R8116:Aox1 UTSW 1 58,115,283 (GRCm39) missense probably damaging 1.00
R8147:Aox1 UTSW 1 58,339,821 (GRCm39) missense probably benign 0.02
R8165:Aox1 UTSW 1 58,348,088 (GRCm39) missense probably benign 0.08
R8179:Aox1 UTSW 1 58,137,117 (GRCm39) missense probably damaging 1.00
R8264:Aox1 UTSW 1 58,092,873 (GRCm39) missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58,115,250 (GRCm39) missense probably damaging 1.00
R8326:Aox1 UTSW 1 58,335,046 (GRCm39) missense probably benign
R8415:Aox1 UTSW 1 58,080,638 (GRCm39) missense probably damaging 1.00
R8770:Aox1 UTSW 1 58,378,763 (GRCm39) missense probably benign 0.10
R8946:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R8973:Aox1 UTSW 1 58,329,113 (GRCm39) missense probably benign 0.34
R8988:Aox1 UTSW 1 58,088,625 (GRCm39) missense possibly damaging 0.48
R9015:Aox1 UTSW 1 58,382,851 (GRCm39) missense probably damaging 1.00
R9097:Aox1 UTSW 1 58,326,887 (GRCm39) missense possibly damaging 0.82
R9101:Aox1 UTSW 1 58,371,796 (GRCm39) missense probably benign 0.03
R9108:Aox1 UTSW 1 58,321,851 (GRCm39) missense probably damaging 1.00
R9180:Aox1 UTSW 1 58,378,777 (GRCm39) nonsense probably null
R9258:Aox1 UTSW 1 58,351,515 (GRCm39) missense probably damaging 1.00
R9293:Aox1 UTSW 1 58,361,953 (GRCm39) missense possibly damaging 0.86
R9296:Aox1 UTSW 1 58,124,612 (GRCm39) missense probably damaging 1.00
R9382:Aox1 UTSW 1 58,104,501 (GRCm39) missense possibly damaging 0.48
R9461:Aox1 UTSW 1 58,116,736 (GRCm39) critical splice donor site probably null
R9519:Aox1 UTSW 1 58,373,926 (GRCm39) missense probably damaging 0.98
R9581:Aox1 UTSW 1 58,370,055 (GRCm39) critical splice donor site probably null
Z1088:Aox1 UTSW 1 58,120,701 (GRCm39) missense probably benign 0.01
Z1177:Aox1 UTSW 1 58,393,556 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCTTAGGTCCACCGTCTGGAGC -3'
(R):5'- GAATAGGTTGCCTGGCCCACAC -3'

Sequencing Primer
(F):5'- agccatctcaccagccc -3'
(R):5'- TGGCCCACACAGCTCTC -3'
Posted On 2014-04-13