Mutagenetix > Incidental Mutation

Incidental Mutation 'R1513:Xirp2'

168475

Institutional Source

Beutler Lab

Gene Symbol

Xirp2

Ensembl Gene

ENSMUSG00000027022

Gene Name

xin actin-binding repeat containing 2

Synonyms

2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta

MMRRC Submission

039560-MU

Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Essential gene?

Possibly non essential (E-score: 0.470) question?

Stock #

R1513 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67446002-67526614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67511530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1372 (I1372V)

Ref Sequence

ENSEMBL: ENSMUSP00000107966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000028410
AA Change: I1372V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: I1372V

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4e-9	PFAM
Pfam:Xin	384	398	7.6e-10	PFAM
Pfam:Xin	420	435	6.4e-9	PFAM
Pfam:Xin	458	473	5.3e-9	PFAM
Pfam:Xin	536	551	4.1e-12	PFAM
Pfam:Xin	574	588	2.1e-8	PFAM
Pfam:Xin	609	623	6e-9	PFAM
Pfam:Xin	642	656	5.6e-8	PFAM
Pfam:Xin	679	693	5.9e-8	PFAM
Pfam:Xin	784	799	1.1e-10	PFAM
Pfam:Xin	822	837	3.9e-11	PFAM
Pfam:Xin	861	875	8.6e-12	PFAM
Pfam:Xin	894	909	2.8e-10	PFAM
Pfam:Xin	1006	1021	3.1e-9	PFAM
Pfam:Xin	1079	1094	6.7e-10	PFAM
Pfam:Xin	1117	1132	1.5e-10	PFAM
Pfam:Xin	1154	1169	2.4e-8	PFAM
Pfam:Xin	1256	1271	4.6e-8	PFAM
Pfam:Xin	1292	1305	1.6e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC
LIM	3256	3308	4.45e-12	SMART
low complexity region	3356	3367	N/A	INTRINSIC
low complexity region	3549	3565	N/A	INTRINSIC
low complexity region	3614	3625	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112347
AA Change: I1372V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: I1372V

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4.3e-8	PFAM
Pfam:Xin	383	398	6.9e-9	PFAM
Pfam:Xin	420	435	1.8e-8	PFAM
Pfam:Xin	458	473	6.9e-8	PFAM
Pfam:Xin	536	551	2.8e-10	PFAM
Pfam:Xin	608	623	2.4e-8	PFAM
Pfam:Xin	642	657	1.7e-7	PFAM
Pfam:Xin	784	799	3.5e-9	PFAM
Pfam:Xin	822	837	8.9e-10	PFAM
Pfam:Xin	861	876	3.9e-10	PFAM
Pfam:Xin	894	909	5.4e-9	PFAM
Pfam:Xin	1006	1021	6.2e-8	PFAM
Pfam:Xin	1079	1094	2.4e-8	PFAM
Pfam:Xin	1117	1132	9.5e-9	PFAM
Pfam:Xin	1291	1306	5.8e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142314

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 87.2%

Validation Efficiency

MGI Phenotype

Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500011B03Rik	A	T	5: 114,809,273	C64*	probably null	Het
1700003H04Rik	A	C	3: 124,575,336	Y109D	possibly damaging	Het
Abca15	A	T	7: 120,340,099	I239F	probably damaging	Het
Adgrv1	A	T	13: 81,556,957	I1578K	probably damaging	Het
Adgrv1	A	G	13: 81,593,048	V99A	probably damaging	Het
Ap4e1	G	T	2: 127,061,555	K792N	probably null	Het
Ap5b1	G	A	19: 5,569,864	W437*	probably null	Het
Arhgef17	A	G	7: 100,930,862	L293P	probably benign	Het
Arhgef33	A	C	17: 80,371,389	M505L	probably benign	Het
Arih1	T	A	9: 59,403,380	R320S	probably damaging	Het
Atp1b3	A	T	9: 96,364,153	M1K	probably null	Het
AU022751	GTCATCATCATCATC	GTCATCATCATCATCATC	X: 6,082,591		probably benign	Het
Bbs2	T	C	8: 94,089,844	D130G	possibly damaging	Het
Bscl2	G	A	19: 8,841,145	R38H	probably damaging	Het
Cad	A	G	5: 31,068,762	Y1102C	probably damaging	Het
Cc2d1b	G	A	4: 108,633,226	R825Q	probably damaging	Het
Ccdc39	A	G	3: 33,839,145	V97A	possibly damaging	Het
Ccr1	T	C	9: 123,964,473	T7A	probably benign	Het
Cd33	A	G	7: 43,532,194	S181P	probably damaging	Het
Cdc20	A	C	4: 118,433,107	S452R	probably damaging	Het
Cdk8	A	T	5: 146,296,378	I229F	possibly damaging	Het
Ces3a	A	T	8: 105,050,277	N131Y	probably damaging	Het
Cgnl1	A	G	9: 71,724,590	I493T	probably benign	Het
Chia1	G	A	3: 106,131,904	V437M	probably benign	Het
Chrna2	G	A	14: 66,143,429	R49H	probably benign	Het
Clec12b	A	G	6: 129,376,302	C241R	probably damaging	Het
Col11a1	A	G	3: 114,097,154	D380G	unknown	Het
Crebbp	A	G	16: 4,115,885	S948P	probably damaging	Het
Dchs1	G	A	7: 105,772,071	R381*	probably null	Het
Defb19	A	T	2: 152,576,165	*84R	probably null	Het
Dnah8	T	C	17: 30,673,888	F816L	probably benign	Het
Dync2h1	T	A	9: 7,103,663	I371F	possibly damaging	Het
Fggy	T	C	4: 95,902,058		probably benign	Het
Galnt12	G	A	4: 47,117,956	C125Y	probably damaging	Het
Gm4952	A	T	19: 12,624,675	D149V	probably damaging	Het
Gm6309	A	T	5: 146,170,583	H37Q	possibly damaging	Het
Gmnn	A	G	13: 24,756,632	L78P	possibly damaging	Het
Golga4	C	A	9: 118,555,732	Q613K	probably benign	Het
Iqgap2	A	T	13: 95,630,010	I1495K	probably damaging	Het
Junb	T	C	8: 84,978,129	T101A	probably damaging	Het
Kif21b	T	C	1: 136,156,111	Y699H	probably damaging	Het
Klf17	T	C	4: 117,760,935	E75G	probably damaging	Het
Klra17	T	C	6: 129,872,314	E99G	possibly damaging	Het
Knop1	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTCTTC	7: 118,852,449		probably benign	Het
Krt83	C	T	15: 101,489,657	V167M	probably benign	Het
Lce1m	A	G	3: 93,018,625		probably benign	Het
Lpin3	A	T	2: 160,904,548	Y709F	probably damaging	Het
Ltbp2	T	A	12: 84,791,944	D1080V	probably damaging	Het
Mycbp2	G	A	14: 103,204,389	T1980I	probably damaging	Het
Myo1g	T	A	11: 6,515,140	K435M	probably damaging	Het
Mypn	T	A	10: 63,169,368	N320I	probably damaging	Het
Naip5	A	T	13: 100,222,206	W841R	probably benign	Het
Ncapd2	A	T	6: 125,170,992	M1124K	probably damaging	Het
Ncf4	A	G	15: 78,262,360	D330G	probably benign	Het
Ndst3	C	T	3: 123,601,455	V509M	possibly damaging	Het
Neb	A	T	2: 52,227,244	D4105E	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nsrp1	A	T	11: 77,046,619	F250L	probably benign	Het
Olfr1024	A	T	2: 85,904,671	Y128N	probably damaging	Het
Olfr1087	C	T	2: 86,690,797	M59I	possibly damaging	Het
Olfr552	G	T	7: 102,605,302	G316V	probably benign	Het
Olfr646	C	T	7: 104,106,464	L62F	probably benign	Het
Olfr724	T	C	14: 49,961,101		probably null	Het
Olfr740	A	G	14: 50,453,681	I210V	probably benign	Het
Oxr1	A	G	15: 41,797,474	D67G	probably damaging	Het
P2ry12	A	T	3: 59,218,077	I59N	probably damaging	Het
Pcdhb12	G	T	18: 37,437,058	G419V	probably damaging	Het
Pdzd2	G	T	15: 12,373,829	S2073R	possibly damaging	Het
Pex5l	C	A	3: 33,015,013	E112*	probably null	Het
Plaur	A	G	7: 24,472,591	D163G	probably benign	Het
Plk2	A	G	13: 110,400,088	Y638C	probably benign	Het
Ppp1r15b	A	G	1: 133,133,350	N535S	probably benign	Het
Ppp2r1b	T	C	9: 50,870,145	L21P	probably damaging	Het
Prkar2a	G	A	9: 108,728,270	V176I	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rag1	A	G	2: 101,642,991	M602T	possibly damaging	Het
Rb1	A	G	14: 73,322,084	V60A	probably benign	Het
Rgs20	T	A	1: 4,912,337	I303F	probably damaging	Het
Rnf43	T	A	11: 87,729,431	I240N	probably damaging	Het
Romo1	G	A	2: 156,144,513	V19M	probably benign	Het
Ryr1	A	G	7: 29,070,621	S2676P	probably damaging	Het
Ryr3	G	A	2: 112,709,197	Q3233*	probably null	Het
Skiv2l	G	T	17: 34,847,444	P188T	probably damaging	Het
Slc26a6	A	G	9: 108,855,836	R5G	probably benign	Het
Slc33a1	A	G	3: 63,963,955	L79P	probably damaging	Het
Snx31	G	A	15: 36,545,600	R91C	probably damaging	Het
Tecpr2	T	C	12: 110,954,800	I1269T	possibly damaging	Het
Tjap1	G	T	17: 46,261,442	D89E	probably benign	Het
Tmem53	A	T	4: 117,265,893	Q39L	probably damaging	Het
Tmod1	G	T	4: 46,083,549	V95F	possibly damaging	Het
Trim30c	A	C	7: 104,382,689	H306Q	probably benign	Het
Trpm3	A	T	19: 22,986,872	M1244L	possibly damaging	Het
Tspan32	A	G	7: 143,005,149	I14V	probably null	Het
Ube4b	A	G	4: 149,351,578	V695A	probably benign	Het
Ubxn11	G	A	4: 134,124,141		probably null	Het
Ugt3a2	A	G	15: 9,361,524	I129V	probably benign	Het
Vmn1r45	A	G	6: 89,933,076	V304A	probably damaging	Het
Vmn2r124	A	T	17: 18,063,273	S410C	probably damaging	Het
Vmn2r15	T	A	5: 109,293,329	D221V	probably damaging	Het
Vmn2r79	G	A	7: 87,037,444	V678I	probably benign	Het
Vps13b	A	T	15: 35,438,730	R319*	probably null	Het
Wdr95	G	A	5: 149,599,294	R639Q	probably benign	Het
Xpo5	T	A	17: 46,226,980	M611K	probably benign	Het
Zfat	A	G	15: 68,212,680	C121R	probably damaging	Het
Zfp382	A	T	7: 30,133,296	Y124F	probably benign	Het
Zfp512b	A	G	2: 181,589,189	F371S	probably benign	Het
Zfy2	A	G	Y: 2,116,185	V285A	probably benign	Het

Other mutations in Xirp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Xirp2	APN	2	67513375	missense	probably benign	0.37
IGL00336:Xirp2	APN	2	67512598	missense	possibly damaging	0.93
IGL00596:Xirp2	APN	2	67514882	missense	probably benign	0.08
IGL00862:Xirp2	APN	2	67516903	missense	probably benign	0.00
IGL01124:Xirp2	APN	2	67508615	missense	probably damaging	0.99
IGL01289:Xirp2	APN	2	67513181	missense	probably damaging	0.99
IGL01293:Xirp2	APN	2	67515184	missense	possibly damaging	0.51
IGL01372:Xirp2	APN	2	67513990	missense	possibly damaging	0.93
IGL01385:Xirp2	APN	2	67509677	missense	probably damaging	0.99
IGL01411:Xirp2	APN	2	67514083	missense	probably benign	0.00
IGL01413:Xirp2	APN	2	67509926	missense	probably damaging	1.00
IGL01551:Xirp2	APN	2	67513505	missense	probably benign
IGL01672:Xirp2	APN	2	67508502	missense	probably benign
IGL01724:Xirp2	APN	2	67526067	missense	probably benign
IGL01739:Xirp2	APN	2	67515138	missense	probably benign	0.15
IGL01807:Xirp2	APN	2	67515031	missense	probably benign
IGL02006:Xirp2	APN	2	67511962	missense	possibly damaging	0.85
IGL02030:Xirp2	APN	2	67508981	missense	probably benign	0.06
IGL02066:Xirp2	APN	2	67526071	missense	probably benign
IGL02138:Xirp2	APN	2	67516956	missense	probably benign	0.15
IGL02250:Xirp2	APN	2	67514012	missense	probably benign	0.03
IGL02265:Xirp2	APN	2	67517150	missense	possibly damaging	0.94
IGL02274:Xirp2	APN	2	67508651	missense	probably benign	0.12
IGL02322:Xirp2	APN	2	67508738	missense	probably benign	0.00
IGL02327:Xirp2	APN	2	67510100	missense	probably damaging	1.00
IGL02378:Xirp2	APN	2	67513768	missense	probably benign	0.00
IGL02492:Xirp2	APN	2	67516167	missense	probably damaging	0.99
IGL02549:Xirp2	APN	2	67513102	missense	probably benign	0.03
IGL02578:Xirp2	APN	2	67511247	missense	probably damaging	0.96
IGL02635:Xirp2	APN	2	67507910	missense	possibly damaging	0.86
IGL02654:Xirp2	APN	2	67514671	missense	possibly damaging	0.86
IGL02663:Xirp2	APN	2	67509458	missense	possibly damaging	0.92
IGL02795:Xirp2	APN	2	67509136	missense	probably damaging	1.00
IGL02934:Xirp2	APN	2	67515676	missense	probably benign	0.33
IGL03003:Xirp2	APN	2	67515562	missense	possibly damaging	0.93
IGL03069:Xirp2	APN	2	67509532	missense	possibly damaging	0.91
IGL03286:Xirp2	APN	2	67516310	missense	probably damaging	0.99
IGL03326:Xirp2	APN	2	67482246	missense	probably benign	0.01
IGL03381:Xirp2	APN	2	67514226	missense	probably benign	0.34
IGL03394:Xirp2	APN	2	67515194	missense	probably damaging	0.99
Ordovician	UTSW	2	67482363	missense	possibly damaging	0.72
silurian	UTSW	2	67519265	missense	probably damaging	0.99
3-1:Xirp2	UTSW	2	67508198	missense	possibly damaging	0.95
H8562:Xirp2	UTSW	2	67515457	missense	probably benign
PIT4142001:Xirp2	UTSW	2	67519362	splice site	probably benign
PIT4260001:Xirp2	UTSW	2	67511597	missense	possibly damaging	0.96
PIT4445001:Xirp2	UTSW	2	67509772	missense	possibly damaging	0.84
PIT4531001:Xirp2	UTSW	2	67515482	missense	possibly damaging	0.73
R0015:Xirp2	UTSW	2	67510899	nonsense	probably null
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0066:Xirp2	UTSW	2	67512140	missense	possibly damaging	0.85
R0109:Xirp2	UTSW	2	67519278	missense	probably damaging	1.00
R0111:Xirp2	UTSW	2	67508378	missense	probably damaging	0.99
R0115:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0117:Xirp2	UTSW	2	67517120	missense	possibly damaging	0.94
R0133:Xirp2	UTSW	2	67517124	missense	probably benign
R0282:Xirp2	UTSW	2	67513380	missense	probably damaging	0.96
R0463:Xirp2	UTSW	2	67514918	missense	probably benign	0.02
R0481:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0488:Xirp2	UTSW	2	67514821	missense	possibly damaging	0.90
R0548:Xirp2	UTSW	2	67514414	missense	probably benign	0.00
R0557:Xirp2	UTSW	2	67516351	missense	probably benign	0.33
R0582:Xirp2	UTSW	2	67508866	missense	probably benign
R0723:Xirp2	UTSW	2	67512215	missense	probably damaging	0.98
R0835:Xirp2	UTSW	2	67507910	missense	possibly damaging	0.86
R1160:Xirp2	UTSW	2	67509887	missense	possibly damaging	0.92
R1189:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R1474:Xirp2	UTSW	2	67525067	missense	probably benign	0.00
R1514:Xirp2	UTSW	2	67514323	nonsense	probably null
R1519:Xirp2	UTSW	2	67515679	missense	probably benign	0.44
R1532:Xirp2	UTSW	2	67513939	missense	probably benign	0.00
R1537:Xirp2	UTSW	2	67510013	missense	probably damaging	0.98
R1541:Xirp2	UTSW	2	67512290	missense	possibly damaging	0.70
R1543:Xirp2	UTSW	2	67508039	missense	probably benign
R1607:Xirp2	UTSW	2	67510295	nonsense	probably null
R1620:Xirp2	UTSW	2	67510835	missense	probably damaging	0.98
R1709:Xirp2	UTSW	2	67509871	missense	probably benign	0.33
R1713:Xirp2	UTSW	2	67512418	missense	probably benign	0.25
R1828:Xirp2	UTSW	2	67515238	missense	possibly damaging	0.86
R1834:Xirp2	UTSW	2	67511140	missense	probably damaging	0.99
R1905:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1907:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1943:Xirp2	UTSW	2	67512615	missense	probably benign	0.34
R1971:Xirp2	UTSW	2	67511695	missense	possibly damaging	0.48
R1998:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R2075:Xirp2	UTSW	2	67510201	missense	probably benign	0.33
R2132:Xirp2	UTSW	2	67508048	missense	possibly damaging	0.72
R2175:Xirp2	UTSW	2	67509914	missense	probably damaging	0.99
R2310:Xirp2	UTSW	2	67526247	missense	probably benign	0.19
R2338:Xirp2	UTSW	2	67510770	missense	probably damaging	0.98
R2426:Xirp2	UTSW	2	67514471	missense	probably benign	0.02
R2483:Xirp2	UTSW	2	67524992	missense	probably benign
R3084:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R3113:Xirp2	UTSW	2	67510147	missense	probably benign	0.33
R3903:Xirp2	UTSW	2	67508036	missense	probably benign	0.40
R3916:Xirp2	UTSW	2	67511422	missense	probably benign	0.25
R3928:Xirp2	UTSW	2	67511669	missense	possibly damaging	0.85
R4025:Xirp2	UTSW	2	67511402	missense	probably benign	0.12
R4135:Xirp2	UTSW	2	67525397	missense	probably benign	0.00
R4223:Xirp2	UTSW	2	67516493	missense	possibly damaging	0.66
R4257:Xirp2	UTSW	2	67516039	missense	probably benign	0.31
R4499:Xirp2	UTSW	2	67513438	missense	probably benign	0.08
R4577:Xirp2	UTSW	2	67513897	missense	probably damaging	0.99
R4739:Xirp2	UTSW	2	67519265	missense	probably damaging	0.99
R4758:Xirp2	UTSW	2	67516535	missense	probably damaging	0.98
R4834:Xirp2	UTSW	2	67516406	missense	probably benign	0.26
R4855:Xirp2	UTSW	2	67511064	missense	possibly damaging	0.96
R4923:Xirp2	UTSW	2	67512893	missense	probably benign
R4936:Xirp2	UTSW	2	67509819	missense	possibly damaging	0.85
R5032:Xirp2	UTSW	2	67525670	missense	possibly damaging	0.84
R5049:Xirp2	UTSW	2	67517134	missense	probably benign	0.03
R5077:Xirp2	UTSW	2	67514477	missense	probably benign
R5090:Xirp2	UTSW	2	67525470	missense	possibly damaging	0.83
R5107:Xirp2	UTSW	2	67509710	missense	probably damaging	0.99
R5107:Xirp2	UTSW	2	67511861	missense	probably damaging	1.00
R5187:Xirp2	UTSW	2	67515367	missense	probably benign	0.01
R5241:Xirp2	UTSW	2	67482360	nonsense	probably null
R5307:Xirp2	UTSW	2	67511162	missense	probably damaging	0.99
R5342:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R5370:Xirp2	UTSW	2	67512152	missense	possibly damaging	0.72
R5375:Xirp2	UTSW	2	67511906	missense	probably damaging	0.99
R5407:Xirp2	UTSW	2	67510969	missense	probably benign	0.33
R5514:Xirp2	UTSW	2	67505121	missense	probably benign	0.03
R5531:Xirp2	UTSW	2	67515302	missense	probably benign	0.42
R5590:Xirp2	UTSW	2	67514035	missense	probably benign	0.23
R5646:Xirp2	UTSW	2	67510790	missense	probably damaging	0.99
R5649:Xirp2	UTSW	2	67516895	missense	probably benign	0.00
R5686:Xirp2	UTSW	2	67482298	missense	probably damaging	0.99
R5761:Xirp2	UTSW	2	67510967	missense	probably benign	0.00
R5777:Xirp2	UTSW	2	67510004	missense	possibly damaging	0.92
R5785:Xirp2	UTSW	2	67509662	missense	probably damaging	0.96
R5843:Xirp2	UTSW	2	67476785	start gained	probably benign
R5846:Xirp2	UTSW	2	67509243	missense	probably damaging	0.98
R5875:Xirp2	UTSW	2	67505080	missense	probably benign	0.00
R5896:Xirp2	UTSW	2	67508698	missense	probably benign	0.32
R5896:Xirp2	UTSW	2	67509946	missense	possibly damaging	0.91
R5901:Xirp2	UTSW	2	67513066	missense	possibly damaging	0.91
R5934:Xirp2	UTSW	2	67524804	missense	possibly damaging	0.92
R5950:Xirp2	UTSW	2	67511320	missense	possibly damaging	0.95
R5996:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6013:Xirp2	UTSW	2	67510943	missense	possibly damaging	0.48
R6048:Xirp2	UTSW	2	67508243	missense	possibly damaging	0.96
R6111:Xirp2	UTSW	2	67511817	missense	possibly damaging	0.86
R6180:Xirp2	UTSW	2	67505577	critical splice donor site	probably null
R6342:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6346:Xirp2	UTSW	2	67516081	missense	probably benign	0.00
R6603:Xirp2	UTSW	2	67516544	missense	probably benign
R6604:Xirp2	UTSW	2	67509845	missense	possibly damaging	0.86
R6669:Xirp2	UTSW	2	67513355	missense	possibly damaging	0.78
R6701:Xirp2	UTSW	2	67516225	missense	possibly damaging	0.94
R6726:Xirp2	UTSW	2	67512868	missense	possibly damaging	0.88
R6833:Xirp2	UTSW	2	67509950	missense	probably benign	0.12
R6897:Xirp2	UTSW	2	67508567	missense	probably damaging	1.00
R6933:Xirp2	UTSW	2	67514857	missense	probably benign	0.34
R7020:Xirp2	UTSW	2	67525569	missense	probably benign
R7042:Xirp2	UTSW	2	67513289	missense	probably benign	0.12
R7060:Xirp2	UTSW	2	67515608	missense	probably damaging	1.00
R7179:Xirp2	UTSW	2	67509833	missense	probably benign	0.00
R7229:Xirp2	UTSW	2	67525551	missense	probably damaging	0.99
R7253:Xirp2	UTSW	2	67513482	missense	probably benign
R7284:Xirp2	UTSW	2	67516829	missense	probably benign
R7450:Xirp2	UTSW	2	67509815	missense	possibly damaging	0.86
R7476:Xirp2	UTSW	2	67510634	missense	probably benign	0.01
R7489:Xirp2	UTSW	2	67525560	missense	possibly damaging	0.83
R7513:Xirp2	UTSW	2	67510764	missense	possibly damaging	0.86
R7549:Xirp2	UTSW	2	67508897	missense	possibly damaging	0.91
R7563:Xirp2	UTSW	2	67509901	missense	probably damaging	0.99
R7567:Xirp2	UTSW	2	67515982	missense	probably benign	0.02
R7577:Xirp2	UTSW	2	67514965	missense	possibly damaging	0.65
R7597:Xirp2	UTSW	2	67525755	missense	possibly damaging	0.84
R7610:Xirp2	UTSW	2	67525962	missense	possibly damaging	0.92
R7613:Xirp2	UTSW	2	67514498	missense	probably benign	0.00
R7669:Xirp2	UTSW	2	67512177	missense	probably benign	0.00
R7670:Xirp2	UTSW	2	67510573	missense	possibly damaging	0.91
R7673:Xirp2	UTSW	2	67517087	missense	probably damaging	1.00
R7682:Xirp2	UTSW	2	67508849	missense	probably damaging	0.99
R7755:Xirp2	UTSW	2	67515182	missense	probably benign
R7805:Xirp2	UTSW	2	67509981	missense	probably benign	0.23
R7815:Xirp2	UTSW	2	67509412	missense	probably damaging	1.00
R7823:Xirp2	UTSW	2	67511774	missense	probably damaging	1.00
R7842:Xirp2	UTSW	2	67524945	missense	probably benign	0.00
R7863:Xirp2	UTSW	2	67512730	missense	probably benign	0.03
R7895:Xirp2	UTSW	2	67509497	missense	probably damaging	0.96
R7948:Xirp2	UTSW	2	67519314	missense	possibly damaging	0.95
R8083:Xirp2	UTSW	2	67508699	missense	possibly damaging	0.71
R8125:Xirp2	UTSW	2	67512035	missense	probably benign	0.25
R8154:Xirp2	UTSW	2	67511673	missense	possibly damaging	0.48
R8169:Xirp2	UTSW	2	67513199	missense	probably benign	0.00
R8213:Xirp2	UTSW	2	67476866	missense	probably damaging	0.96
R8215:Xirp2	UTSW	2	67516509	missense	probably benign	0.08
R8230:Xirp2	UTSW	2	67515665	missense	probably damaging	0.99
R8266:Xirp2	UTSW	2	67508574	missense	probably damaging	0.98
R8350:Xirp2	UTSW	2	67525369	missense	probably benign
R8432:Xirp2	UTSW	2	67510618	missense	probably benign
R8441:Xirp2	UTSW	2	67512815	missense	possibly damaging	0.85
R8677:Xirp2	UTSW	2	67516634	missense	probably damaging	0.98
R8773:Xirp2	UTSW	2	67525183	missense	probably benign
R8794:Xirp2	UTSW	2	67511213	missense	probably damaging	0.98
R8930:Xirp2	UTSW	2	67482363	missense	possibly damaging	0.72
R8932:Xirp2	UTSW	2	67482363	missense	possibly damaging	0.72
R8939:Xirp2	UTSW	2	67516144	missense	probably benign	0.04
R9263:Xirp2	UTSW	2	67514945	missense	possibly damaging	0.76
R9313:Xirp2	UTSW	2	67516978	missense	probably damaging	0.99
R9350:Xirp2	UTSW	2	67519309	missense	probably damaging	1.00
R9375:Xirp2	UTSW	2	67511774	missense	probably damaging	1.00
R9442:Xirp2	UTSW	2	67511891	nonsense	probably null
R9447:Xirp2	UTSW	2	67508606	missense	probably damaging	0.98
R9457:Xirp2	UTSW	2	67515632	missense	probably benign	0.03
R9507:Xirp2	UTSW	2	67513936	missense	possibly damaging	0.95
R9529:Xirp2	UTSW	2	67525196	missense	possibly damaging	0.93
R9569:Xirp2	UTSW	2	67510898	missense	probably damaging	1.00
R9607:Xirp2	UTSW	2	67510762	missense	possibly damaging	0.72
R9648:Xirp2	UTSW	2	67516255	missense	probably benign
R9651:Xirp2	UTSW	2	67513823	missense	possibly damaging	0.72
R9678:Xirp2	UTSW	2	67509444	missense	possibly damaging	0.91
R9691:Xirp2	UTSW	2	67510195	missense	possibly damaging	0.91
R9777:Xirp2	UTSW	2	67517035	missense	possibly damaging	0.85
RF035:Xirp2	UTSW	2	67525544	utr 3 prime	probably benign
RF040:Xirp2	UTSW	2	67525544	utr 3 prime	probably benign
X0063:Xirp2	UTSW	2	67516123	missense	probably benign	0.04
X0065:Xirp2	UTSW	2	67515118	missense	probably benign	0.34
Z1088:Xirp2	UTSW	2	67513321	missense	probably benign	0.03
Z1176:Xirp2	UTSW	2	67511393	missense	probably damaging	0.99
Z1176:Xirp2	UTSW	2	67514579	missense	probably benign	0.17
Z1176:Xirp2	UTSW	2	67525232	missense	probably damaging	1.00
Z1177:Xirp2	UTSW	2	67510193	frame shift	probably null
Z1177:Xirp2	UTSW	2	67525371	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCTCCGTCGGATGTCAAGACAAC -3'
(R):5'- TGCACGCCTTTCCTCTGAGAAC -3'

Sequencing Primer
(F):5'- ACGTGGCTCTTTGAAACAAC -3'
(R):5'- CCTCTGAGAACAGCTTTTGGATTG -3'

Posted On

2014-04-13