Mutagenetix > Incidental Mutation

Incidental Mutation 'R1513:Rag1'

168478

Institutional Source

Beutler Lab

Gene Symbol

Rag1

Ensembl Gene

ENSMUSG00000061311

Gene Name

recombination activating gene 1

Synonyms

Rag-1

MMRRC Submission

039560-MU

Accession Numbers

MGI:97848

Essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R1513 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101638282-101649501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101642991 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 602 (M602T)

Ref Sequence

ENSEMBL: ENSMUSP00000077584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078494] [ENSMUST00000160037] [ENSMUST00000160722]

AlphaFold

P15919

PDB Structure

RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078494
AA Change: M602T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000077584
Gene: ENSMUSG00000061311
AA Change: M602T

Domain	Start	End	E-Value	Type
Pfam:RAG1_imp_bd	11	288	5.7e-120	PFAM
RING	290	328	1.39e-3	SMART
ZnF_C2H2	353	376	2.61e1	SMART
PDB:3GNB\|A	389	464	3e-44	PDB
ZnF_C2H2	725	750	7e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160037

Predicted Effect

probably benign
Transcript: ENSMUST00000160722

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177171

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 87.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be the cause of several diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(10) Chemically induced(3)

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500011B03Rik	A	T	5: 114,809,273	C64*	probably null	Het
1700003H04Rik	A	C	3: 124,575,336	Y109D	possibly damaging	Het
Abca15	A	T	7: 120,340,099	I239F	probably damaging	Het
Adgrv1	A	T	13: 81,556,957	I1578K	probably damaging	Het
Adgrv1	A	G	13: 81,593,048	V99A	probably damaging	Het
Ap4e1	G	T	2: 127,061,555	K792N	probably null	Het
Ap5b1	G	A	19: 5,569,864	W437*	probably null	Het
Arhgef17	A	G	7: 100,930,862	L293P	probably benign	Het
Arhgef33	A	C	17: 80,371,389	M505L	probably benign	Het
Arih1	T	A	9: 59,403,380	R320S	probably damaging	Het
Atp1b3	A	T	9: 96,364,153	M1K	probably null	Het
AU022751	GTCATCATCATCATC	GTCATCATCATCATCATC	X: 6,082,591		probably benign	Het
Bbs2	T	C	8: 94,089,844	D130G	possibly damaging	Het
Bscl2	G	A	19: 8,841,145	R38H	probably damaging	Het
Cad	A	G	5: 31,068,762	Y1102C	probably damaging	Het
Cc2d1b	G	A	4: 108,633,226	R825Q	probably damaging	Het
Ccdc39	A	G	3: 33,839,145	V97A	possibly damaging	Het
Ccr1	T	C	9: 123,964,473	T7A	probably benign	Het
Cd33	A	G	7: 43,532,194	S181P	probably damaging	Het
Cdc20	A	C	4: 118,433,107	S452R	probably damaging	Het
Cdk8	A	T	5: 146,296,378	I229F	possibly damaging	Het
Ces3a	A	T	8: 105,050,277	N131Y	probably damaging	Het
Cgnl1	A	G	9: 71,724,590	I493T	probably benign	Het
Chia1	G	A	3: 106,131,904	V437M	probably benign	Het
Chrna2	G	A	14: 66,143,429	R49H	probably benign	Het
Clec12b	A	G	6: 129,376,302	C241R	probably damaging	Het
Col11a1	A	G	3: 114,097,154	D380G	unknown	Het
Crebbp	A	G	16: 4,115,885	S948P	probably damaging	Het
Dchs1	G	A	7: 105,772,071	R381*	probably null	Het
Defb19	A	T	2: 152,576,165	*84R	probably null	Het
Dnah8	T	C	17: 30,673,888	F816L	probably benign	Het
Dync2h1	T	A	9: 7,103,663	I371F	possibly damaging	Het
Fggy	T	C	4: 95,902,058		probably benign	Het
Galnt12	G	A	4: 47,117,956	C125Y	probably damaging	Het
Gm4952	A	T	19: 12,624,675	D149V	probably damaging	Het
Gm6309	A	T	5: 146,170,583	H37Q	possibly damaging	Het
Gmnn	A	G	13: 24,756,632	L78P	possibly damaging	Het
Golga4	C	A	9: 118,555,732	Q613K	probably benign	Het
Iqgap2	A	T	13: 95,630,010	I1495K	probably damaging	Het
Junb	T	C	8: 84,978,129	T101A	probably damaging	Het
Kif21b	T	C	1: 136,156,111	Y699H	probably damaging	Het
Klf17	T	C	4: 117,760,935	E75G	probably damaging	Het
Klra17	T	C	6: 129,872,314	E99G	possibly damaging	Het
Knop1	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTCTTC	7: 118,852,449		probably benign	Het
Krt83	C	T	15: 101,489,657	V167M	probably benign	Het
Lce1m	A	G	3: 93,018,625		probably benign	Het
Lpin3	A	T	2: 160,904,548	Y709F	probably damaging	Het
Ltbp2	T	A	12: 84,791,944	D1080V	probably damaging	Het
Mycbp2	G	A	14: 103,204,389	T1980I	probably damaging	Het
Myo1g	T	A	11: 6,515,140	K435M	probably damaging	Het
Mypn	T	A	10: 63,169,368	N320I	probably damaging	Het
Naip5	A	T	13: 100,222,206	W841R	probably benign	Het
Ncapd2	A	T	6: 125,170,992	M1124K	probably damaging	Het
Ncf4	A	G	15: 78,262,360	D330G	probably benign	Het
Ndst3	C	T	3: 123,601,455	V509M	possibly damaging	Het
Neb	A	T	2: 52,227,244	D4105E	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nsrp1	A	T	11: 77,046,619	F250L	probably benign	Het
Olfr1024	A	T	2: 85,904,671	Y128N	probably damaging	Het
Olfr1087	C	T	2: 86,690,797	M59I	possibly damaging	Het
Olfr552	G	T	7: 102,605,302	G316V	probably benign	Het
Olfr646	C	T	7: 104,106,464	L62F	probably benign	Het
Olfr724	T	C	14: 49,961,101		probably null	Het
Olfr740	A	G	14: 50,453,681	I210V	probably benign	Het
Oxr1	A	G	15: 41,797,474	D67G	probably damaging	Het
P2ry12	A	T	3: 59,218,077	I59N	probably damaging	Het
Pcdhb12	G	T	18: 37,437,058	G419V	probably damaging	Het
Pdzd2	G	T	15: 12,373,829	S2073R	possibly damaging	Het
Pex5l	C	A	3: 33,015,013	E112*	probably null	Het
Plaur	A	G	7: 24,472,591	D163G	probably benign	Het
Plk2	A	G	13: 110,400,088	Y638C	probably benign	Het
Ppp1r15b	A	G	1: 133,133,350	N535S	probably benign	Het
Ppp2r1b	T	C	9: 50,870,145	L21P	probably damaging	Het
Prkar2a	G	A	9: 108,728,270	V176I	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rb1	A	G	14: 73,322,084	V60A	probably benign	Het
Rgs20	T	A	1: 4,912,337	I303F	probably damaging	Het
Rnf43	T	A	11: 87,729,431	I240N	probably damaging	Het
Romo1	G	A	2: 156,144,513	V19M	probably benign	Het
Ryr1	A	G	7: 29,070,621	S2676P	probably damaging	Het
Ryr3	G	A	2: 112,709,197	Q3233*	probably null	Het
Skiv2l	G	T	17: 34,847,444	P188T	probably damaging	Het
Slc26a6	A	G	9: 108,855,836	R5G	probably benign	Het
Slc33a1	A	G	3: 63,963,955	L79P	probably damaging	Het
Snx31	G	A	15: 36,545,600	R91C	probably damaging	Het
Tecpr2	T	C	12: 110,954,800	I1269T	possibly damaging	Het
Tjap1	G	T	17: 46,261,442	D89E	probably benign	Het
Tmem53	A	T	4: 117,265,893	Q39L	probably damaging	Het
Tmod1	G	T	4: 46,083,549	V95F	possibly damaging	Het
Trim30c	A	C	7: 104,382,689	H306Q	probably benign	Het
Trpm3	A	T	19: 22,986,872	M1244L	possibly damaging	Het
Tspan32	A	G	7: 143,005,149	I14V	probably null	Het
Ube4b	A	G	4: 149,351,578	V695A	probably benign	Het
Ubxn11	G	A	4: 134,124,141		probably null	Het
Ugt3a2	A	G	15: 9,361,524	I129V	probably benign	Het
Vmn1r45	A	G	6: 89,933,076	V304A	probably damaging	Het
Vmn2r124	A	T	17: 18,063,273	S410C	probably damaging	Het
Vmn2r15	T	A	5: 109,293,329	D221V	probably damaging	Het
Vmn2r79	G	A	7: 87,037,444	V678I	probably benign	Het
Vps13b	A	T	15: 35,438,730	R319*	probably null	Het
Wdr95	G	A	5: 149,599,294	R639Q	probably benign	Het
Xirp2	A	G	2: 67,511,530	I1372V	probably benign	Het
Xpo5	T	A	17: 46,226,980	M611K	probably benign	Het
Zfat	A	G	15: 68,212,680	C121R	probably damaging	Het
Zfp382	A	T	7: 30,133,296	Y124F	probably benign	Het
Zfp512b	A	G	2: 181,589,189	F371S	probably benign	Het
Zfy2	A	G	Y: 2,116,185	V285A	probably benign	Het

Other mutations in Rag1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Rag1	APN	2	101642388	missense	probably damaging	1.00
IGL01125:Rag1	APN	2	101642001	missense	probably damaging	0.99
IGL01836:Rag1	APN	2	101641894	missense	probably damaging	1.00
IGL02216:Rag1	APN	2	101643381	missense	possibly damaging	0.91
IGL02271:Rag1	APN	2	101643388	missense	probably damaging	0.99
IGL02293:Rag1	APN	2	101643046	missense	probably benign	0.39
IGL02601:Rag1	APN	2	101642673	missense	probably damaging	1.00
Anne	UTSW	2	101643516	missense	probably damaging	0.99
busted	UTSW	2	101641947	missense	probably damaging	1.00
cloth	UTSW	2	101642664	missense	probably damaging	1.00
defective	UTSW	2	101642710	missense	probably damaging	1.00
doll	UTSW	2	101642070	missense	probably damaging	1.00
dysfunctional	UTSW	2	101644284	missense	probably damaging	1.00
furchte	UTSW	2	101644507	missense	probably benign	0.05
horrorshow	UTSW	2	101642623	missense	probably damaging	1.00
huckle	UTSW	2	101641223	intron	probably benign
maladaptive	UTSW	2	101645647	intron	probably benign
scarecrow	UTSW	2	101642507	missense	probably damaging	1.00
R0658:Rag1	UTSW	2	101642683	missense	probably damaging	0.99
R1126:Rag1	UTSW	2	101642689	missense	probably damaging	1.00
R1177:Rag1	UTSW	2	101642278	missense	probably benign	0.10
R1319:Rag1	UTSW	2	101643192	missense	probably damaging	1.00
R1859:Rag1	UTSW	2	101644062	missense	probably benign	0.03
R2218:Rag1	UTSW	2	101644146	missense	probably benign
R3932:Rag1	UTSW	2	101643039	missense	probably damaging	1.00
R4127:Rag1	UTSW	2	101642071	missense	probably damaging	1.00
R4365:Rag1	UTSW	2	101642943	missense	probably damaging	1.00
R4620:Rag1	UTSW	2	101643680	missense	probably damaging	1.00
R4815:Rag1	UTSW	2	101643516	missense	probably damaging	0.99
R5070:Rag1	UTSW	2	101642311	missense	probably damaging	1.00
R5209:Rag1	UTSW	2	101644215	missense	probably benign	0.01
R5239:Rag1	UTSW	2	101642955	missense	possibly damaging	0.91
R5390:Rag1	UTSW	2	101642734	missense	probably benign
R5607:Rag1	UTSW	2	101643792	missense	probably damaging	1.00
R6259:Rag1	UTSW	2	101644452	missense	possibly damaging	0.83
R6412:Rag1	UTSW	2	101642520	missense	probably damaging	0.99
R6633:Rag1	UTSW	2	101642710	missense	probably damaging	1.00
R6679:Rag1	UTSW	2	101644284	missense	probably damaging	1.00
R6723:Rag1	UTSW	2	101643645	missense	probably damaging	0.99
R6853:Rag1	UTSW	2	101642221	missense	probably damaging	0.99
R6867:Rag1	UTSW	2	101641947	missense	probably damaging	1.00
R6974:Rag1	UTSW	2	101641792	missense	probably damaging	0.99
R7071:Rag1	UTSW	2	101643462	missense	probably damaging	0.99
R7124:Rag1	UTSW	2	101643783	missense	probably damaging	0.99
R7248:Rag1	UTSW	2	101641778	missense	probably damaging	0.99
R7256:Rag1	UTSW	2	101642070	missense	probably damaging	1.00
R7567:Rag1	UTSW	2	101643661	missense	probably damaging	0.98
R7581:Rag1	UTSW	2	101643304	missense	possibly damaging	0.95
R7830:Rag1	UTSW	2	101642059	missense	probably damaging	1.00
R7941:Rag1	UTSW	2	101642346	missense	probably benign	0.24
R8024:Rag1	UTSW	2	101642507	missense	probably damaging	1.00
R8434:Rag1	UTSW	2	101642664	missense	probably damaging	1.00
R8688:Rag1	UTSW	2	101642623	missense	probably damaging	1.00
R8918:Rag1	UTSW	2	101641753	missense	probably benign
R9116:Rag1	UTSW	2	101642475	missense	probably damaging	1.00
R9116:Rag1	UTSW	2	101644792	missense	probably benign	0.38
R9210:Rag1	UTSW	2	101644507	missense	probably benign	0.05
R9409:Rag1	UTSW	2	101642847	missense	probably damaging	1.00
R9562:Rag1	UTSW	2	101642982	missense	probably damaging	1.00
R9565:Rag1	UTSW	2	101642982	missense	probably damaging	1.00
R9594:Rag1	UTSW	2	101644356	missense	probably benign
R9658:Rag1	UTSW	2	101642884	missense	possibly damaging	0.83
R9779:Rag1	UTSW	2	101643808	missense	probably damaging	1.00
X0018:Rag1	UTSW	2	101643597	missense	probably damaging	1.00
X0018:Rag1	UTSW	2	101644547	missense	probably damaging	0.99
Z1176:Rag1	UTSW	2	101643259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCAGACTCATCTGCCAGCATAAG -3'
(R):5'- AAGTCCTTCTGCCAGGCTACCATC -3'

Sequencing Primer
(F):5'- GCATAAGACACAACGGCTTG -3'
(R):5'- GAATGTGTCCTCCAGAACTGATG -3'

Posted On

2014-04-13