Mutagenetix > Incidental Mutation

Incidental Mutation 'R1513:Ryr1'

168520

Institutional Source

Beutler Lab

Gene Symbol

Ryr1

Ensembl Gene

ENSMUSG00000030592

Gene Name

ryanodine receptor 1, skeletal muscle

Synonyms

skrr, calcium release channel isoform 1, Ryr

MMRRC Submission

039560-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1513 (G1)

Quality Score

125

Status

Not validated

Chromosome

Chromosomal Location

29003344-29125179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29070621 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2676 (S2676P)

Ref Sequence

ENSEMBL: ENSMUSP00000149042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032813
AA Change: S2669P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: S2669P

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	441	645	1.2e-73	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	851	945	6.5e-33	PFAM
Pfam:RyR	965	1059	1.5e-30	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2158	2366	7e-66	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2735	2829	9.7e-34	PFAM
Pfam:RyR	2855	2943	5.7e-32	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3613	3642	2e-13	PDB
low complexity region	3681	3691	N/A	INTRINSIC
low complexity region	3735	3760	N/A	INTRINSIC
Pfam:RIH_assoc	3872	4004	1.9e-41	PFAM
low complexity region	4010	4023	N/A	INTRINSIC
Pfam:EF-hand_8	4085	4136	9.8e-8	PFAM
transmembrane domain	4283	4305	N/A	INTRINSIC
transmembrane domain	4318	4336	N/A	INTRINSIC
transmembrane domain	4341	4363	N/A	INTRINSIC
Pfam:RR_TM4-6	4377	4666	2e-86	PFAM
Pfam:Ion_trans	4761	4932	3.4e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179893
AA Change: S2669P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: S2669P

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
MIR	99	154	7.52e-4	SMART
MIR	161	206	1.11e-6	SMART
MIR	212	266	1.23e-8	SMART
MIR	272	362	1.05e-25	SMART
Pfam:RYDR_ITPR	443	638	4.5e-63	PFAM
SPRY	660	798	2.79e-27	SMART
Pfam:RyR	852	942	1.3e-37	PFAM
Pfam:RyR	966	1056	1.6e-28	PFAM
SPRY	1086	1209	8.62e-42	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1340	1349	N/A	INTRINSIC
SPRY	1431	1571	3.05e-33	SMART
low complexity region	1787	1798	N/A	INTRINSIC
coiled coil region	1871	1932	N/A	INTRINSIC
low complexity region	1989	1998	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2069	2092	N/A	INTRINSIC
Pfam:RYDR_ITPR	2160	2366	2.2e-68	PFAM
low complexity region	2390	2404	N/A	INTRINSIC
Pfam:RyR	2736	2826	7.2e-31	PFAM
Pfam:RyR	2856	2940	5.6e-27	PFAM
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3290	3304	N/A	INTRINSIC
low complexity region	3375	3394	N/A	INTRINSIC
PDB:2BCX\|B	3615	3644	2e-13	PDB
low complexity region	3683	3693	N/A	INTRINSIC
low complexity region	3737	3762	N/A	INTRINSIC
Pfam:RIH_assoc	3878	3996	6.2e-35	PFAM
low complexity region	4012	4025	N/A	INTRINSIC
Pfam:EF-hand_8	4087	4137	1.8e-8	PFAM
transmembrane domain	4285	4307	N/A	INTRINSIC
transmembrane domain	4320	4338	N/A	INTRINSIC
transmembrane domain	4343	4365	N/A	INTRINSIC
Pfam:RR_TM4-6	4379	4668	8.4e-76	PFAM
Pfam:Ion_trans	4763	4946	2.8e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207764

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209109

Predicted Effect

probably damaging
Transcript: ENSMUST00000214374
AA Change: S2676P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 87.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500011B03Rik	A	T	5: 114,809,273	C64*	probably null	Het
1700003H04Rik	A	C	3: 124,575,336	Y109D	possibly damaging	Het
Abca15	A	T	7: 120,340,099	I239F	probably damaging	Het
Adgrv1	A	T	13: 81,556,957	I1578K	probably damaging	Het
Adgrv1	A	G	13: 81,593,048	V99A	probably damaging	Het
Ap4e1	G	T	2: 127,061,555	K792N	probably null	Het
Ap5b1	G	A	19: 5,569,864	W437*	probably null	Het
Arhgef17	A	G	7: 100,930,862	L293P	probably benign	Het
Arhgef33	A	C	17: 80,371,389	M505L	probably benign	Het
Arih1	T	A	9: 59,403,380	R320S	probably damaging	Het
Atp1b3	A	T	9: 96,364,153	M1K	probably null	Het
AU022751	GTCATCATCATCATC	GTCATCATCATCATCATC	X: 6,082,591		probably benign	Het
Bbs2	T	C	8: 94,089,844	D130G	possibly damaging	Het
Bscl2	G	A	19: 8,841,145	R38H	probably damaging	Het
Cad	A	G	5: 31,068,762	Y1102C	probably damaging	Het
Cc2d1b	G	A	4: 108,633,226	R825Q	probably damaging	Het
Ccdc39	A	G	3: 33,839,145	V97A	possibly damaging	Het
Ccr1	T	C	9: 123,964,473	T7A	probably benign	Het
Cd33	A	G	7: 43,532,194	S181P	probably damaging	Het
Cdc20	A	C	4: 118,433,107	S452R	probably damaging	Het
Cdk8	A	T	5: 146,296,378	I229F	possibly damaging	Het
Ces3a	A	T	8: 105,050,277	N131Y	probably damaging	Het
Cgnl1	A	G	9: 71,724,590	I493T	probably benign	Het
Chia1	G	A	3: 106,131,904	V437M	probably benign	Het
Chrna2	G	A	14: 66,143,429	R49H	probably benign	Het
Clec12b	A	G	6: 129,376,302	C241R	probably damaging	Het
Col11a1	A	G	3: 114,097,154	D380G	unknown	Het
Crebbp	A	G	16: 4,115,885	S948P	probably damaging	Het
Dchs1	G	A	7: 105,772,071	R381*	probably null	Het
Defb19	A	T	2: 152,576,165	*84R	probably null	Het
Dnah8	T	C	17: 30,673,888	F816L	probably benign	Het
Dync2h1	T	A	9: 7,103,663	I371F	possibly damaging	Het
Fggy	T	C	4: 95,902,058		probably benign	Het
Galnt12	G	A	4: 47,117,956	C125Y	probably damaging	Het
Gm4952	A	T	19: 12,624,675	D149V	probably damaging	Het
Gm6309	A	T	5: 146,170,583	H37Q	possibly damaging	Het
Gmnn	A	G	13: 24,756,632	L78P	possibly damaging	Het
Golga4	C	A	9: 118,555,732	Q613K	probably benign	Het
Iqgap2	A	T	13: 95,630,010	I1495K	probably damaging	Het
Junb	T	C	8: 84,978,129	T101A	probably damaging	Het
Kif21b	T	C	1: 136,156,111	Y699H	probably damaging	Het
Klf17	T	C	4: 117,760,935	E75G	probably damaging	Het
Klra17	T	C	6: 129,872,314	E99G	possibly damaging	Het
Knop1	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTCTTC	7: 118,852,449		probably benign	Het
Krt83	C	T	15: 101,489,657	V167M	probably benign	Het
Lce1m	A	G	3: 93,018,625		probably benign	Het
Lpin3	A	T	2: 160,904,548	Y709F	probably damaging	Het
Ltbp2	T	A	12: 84,791,944	D1080V	probably damaging	Het
Mycbp2	G	A	14: 103,204,389	T1980I	probably damaging	Het
Myo1g	T	A	11: 6,515,140	K435M	probably damaging	Het
Mypn	T	A	10: 63,169,368	N320I	probably damaging	Het
Naip5	A	T	13: 100,222,206	W841R	probably benign	Het
Ncapd2	A	T	6: 125,170,992	M1124K	probably damaging	Het
Ncf4	A	G	15: 78,262,360	D330G	probably benign	Het
Ndst3	C	T	3: 123,601,455	V509M	possibly damaging	Het
Neb	A	T	2: 52,227,244	D4105E	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nsrp1	A	T	11: 77,046,619	F250L	probably benign	Het
Olfr1024	A	T	2: 85,904,671	Y128N	probably damaging	Het
Olfr1087	C	T	2: 86,690,797	M59I	possibly damaging	Het
Olfr552	G	T	7: 102,605,302	G316V	probably benign	Het
Olfr646	C	T	7: 104,106,464	L62F	probably benign	Het
Olfr724	T	C	14: 49,961,101		probably null	Het
Olfr740	A	G	14: 50,453,681	I210V	probably benign	Het
Oxr1	A	G	15: 41,797,474	D67G	probably damaging	Het
P2ry12	A	T	3: 59,218,077	I59N	probably damaging	Het
Pcdhb12	G	T	18: 37,437,058	G419V	probably damaging	Het
Pdzd2	G	T	15: 12,373,829	S2073R	possibly damaging	Het
Pex5l	C	A	3: 33,015,013	E112*	probably null	Het
Plaur	A	G	7: 24,472,591	D163G	probably benign	Het
Plk2	A	G	13: 110,400,088	Y638C	probably benign	Het
Ppp1r15b	A	G	1: 133,133,350	N535S	probably benign	Het
Ppp2r1b	T	C	9: 50,870,145	L21P	probably damaging	Het
Prkar2a	G	A	9: 108,728,270	V176I	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rag1	A	G	2: 101,642,991	M602T	possibly damaging	Het
Rb1	A	G	14: 73,322,084	V60A	probably benign	Het
Rgs20	T	A	1: 4,912,337	I303F	probably damaging	Het
Rnf43	T	A	11: 87,729,431	I240N	probably damaging	Het
Romo1	G	A	2: 156,144,513	V19M	probably benign	Het
Ryr3	G	A	2: 112,709,197	Q3233*	probably null	Het
Skiv2l	G	T	17: 34,847,444	P188T	probably damaging	Het
Slc26a6	A	G	9: 108,855,836	R5G	probably benign	Het
Slc33a1	A	G	3: 63,963,955	L79P	probably damaging	Het
Snx31	G	A	15: 36,545,600	R91C	probably damaging	Het
Tecpr2	T	C	12: 110,954,800	I1269T	possibly damaging	Het
Tjap1	G	T	17: 46,261,442	D89E	probably benign	Het
Tmem53	A	T	4: 117,265,893	Q39L	probably damaging	Het
Tmod1	G	T	4: 46,083,549	V95F	possibly damaging	Het
Trim30c	A	C	7: 104,382,689	H306Q	probably benign	Het
Trpm3	A	T	19: 22,986,872	M1244L	possibly damaging	Het
Tspan32	A	G	7: 143,005,149	I14V	probably null	Het
Ube4b	A	G	4: 149,351,578	V695A	probably benign	Het
Ubxn11	G	A	4: 134,124,141		probably null	Het
Ugt3a2	A	G	15: 9,361,524	I129V	probably benign	Het
Vmn1r45	A	G	6: 89,933,076	V304A	probably damaging	Het
Vmn2r124	A	T	17: 18,063,273	S410C	probably damaging	Het
Vmn2r15	T	A	5: 109,293,329	D221V	probably damaging	Het
Vmn2r79	G	A	7: 87,037,444	V678I	probably benign	Het
Vps13b	A	T	15: 35,438,730	R319*	probably null	Het
Wdr95	G	A	5: 149,599,294	R639Q	probably benign	Het
Xirp2	A	G	2: 67,511,530	I1372V	probably benign	Het
Xpo5	T	A	17: 46,226,980	M611K	probably benign	Het
Zfat	A	G	15: 68,212,680	C121R	probably damaging	Het
Zfp382	A	T	7: 30,133,296	Y124F	probably benign	Het
Zfp512b	A	G	2: 181,589,189	F371S	probably benign	Het
Zfy2	A	G	Y: 2,116,185	V285A	probably benign	Het

Other mutations in Ryr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ryr1	APN	7	29102810	missense	probably damaging	1.00
IGL00335:Ryr1	APN	7	29124960	splice site	probably null
IGL00427:Ryr1	APN	7	29104737	splice site	probably benign
IGL00559:Ryr1	APN	7	29012242	splice site	probably benign
IGL00803:Ryr1	APN	7	29069645	missense	possibly damaging	0.95
IGL00886:Ryr1	APN	7	29024229	missense	probably damaging	1.00
IGL00948:Ryr1	APN	7	29020195	missense	possibly damaging	0.78
IGL01017:Ryr1	APN	7	29082543	missense	probably damaging	0.99
IGL01116:Ryr1	APN	7	29100202	splice site	probably benign
IGL01385:Ryr1	APN	7	29056985	missense	probably damaging	1.00
IGL01482:Ryr1	APN	7	29052337	missense	probably damaging	1.00
IGL01529:Ryr1	APN	7	29075227	missense	probably damaging	1.00
IGL01543:Ryr1	APN	7	29091076	missense	probably damaging	1.00
IGL01653:Ryr1	APN	7	29078597	missense	probably damaging	0.99
IGL01701:Ryr1	APN	7	29059810	missense	probably damaging	0.98
IGL02051:Ryr1	APN	7	29071658	missense	probably benign	0.16
IGL02152:Ryr1	APN	7	29052015	missense	possibly damaging	0.95
IGL02271:Ryr1	APN	7	29094047	missense	probably benign	0.07
IGL02321:Ryr1	APN	7	29078696	missense	probably damaging	1.00
IGL02448:Ryr1	APN	7	29105066	splice site	probably benign
IGL02472:Ryr1	APN	7	29040844	missense	probably damaging	1.00
IGL02544:Ryr1	APN	7	29115599	missense	probably benign	0.24
IGL02666:Ryr1	APN	7	29019763	missense	unknown
IGL02672:Ryr1	APN	7	29004519	unclassified	probably benign
IGL02677:Ryr1	APN	7	29110608	missense	probably benign	0.18
IGL02686:Ryr1	APN	7	29069550	splice site	probably benign
IGL02751:Ryr1	APN	7	29078774	missense	probably damaging	1.00
IGL02899:Ryr1	APN	7	29048795	missense	possibly damaging	0.53
IGL02926:Ryr1	APN	7	29061540	missense	probably damaging	1.00
IGL02950:Ryr1	APN	7	29097459	missense	probably damaging	1.00
IGL02960:Ryr1	APN	7	29060053	missense	probably damaging	1.00
IGL02968:Ryr1	APN	7	29043893	missense	probably damaging	1.00
IGL03070:Ryr1	APN	7	29070659	missense	probably damaging	1.00
IGL03091:Ryr1	APN	7	29083486	missense	possibly damaging	0.85
IGL03100:Ryr1	APN	7	29104593	missense	probably damaging	1.00
IGL03107:Ryr1	APN	7	29075199	missense	probably damaging	1.00
IGL03117:Ryr1	APN	7	29102964	missense	probably damaging	1.00
IGL03118:Ryr1	APN	7	29015786	missense	unknown
IGL03146:Ryr1	APN	7	29094032	missense	probably benign	0.09
IGL03165:Ryr1	APN	7	29105040	missense	probably benign	0.22
IGL03220:Ryr1	APN	7	29059855	missense	probably damaging	1.00
R0017:Ryr1	UTSW	7	29047542	missense	probably damaging	1.00
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0066:Ryr1	UTSW	7	29005567	unclassified	probably benign
R0069:Ryr1	UTSW	7	29110505	splice site	probably benign
R0148:Ryr1	UTSW	7	29052035	missense	probably damaging	0.99
R0266:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0346:Ryr1	UTSW	7	29067588	splice site	probably benign
R0387:Ryr1	UTSW	7	29083367	splice site	probably benign
R0454:Ryr1	UTSW	7	29036075	missense	probably damaging	0.99
R0494:Ryr1	UTSW	7	29003793	splice site	probably benign
R0533:Ryr1	UTSW	7	29078780	missense	probably damaging	1.00
R0585:Ryr1	UTSW	7	29036076	missense	probably damaging	1.00
R0591:Ryr1	UTSW	7	29104795	missense	possibly damaging	0.68
R0624:Ryr1	UTSW	7	29074609	missense	probably damaging	1.00
R0662:Ryr1	UTSW	7	29100189	missense	probably damaging	1.00
R0849:Ryr1	UTSW	7	29040679	missense	probably damaging	1.00
R0961:Ryr1	UTSW	7	29009697	missense	unknown
R1052:Ryr1	UTSW	7	29096258	missense	probably damaging	0.96
R1218:Ryr1	UTSW	7	29086109	missense	possibly damaging	0.79
R1340:Ryr1	UTSW	7	29116012	missense	probably damaging	0.99
R1543:Ryr1	UTSW	7	29083537	missense	possibly damaging	0.67
R1566:Ryr1	UTSW	7	29092175	missense	possibly damaging	0.95
R1572:Ryr1	UTSW	7	29062191	missense	probably damaging	1.00
R1623:Ryr1	UTSW	7	29095490	missense	probably damaging	1.00
R1632:Ryr1	UTSW	7	29094261	missense	probably benign	0.03
R1661:Ryr1	UTSW	7	29101738	missense	probably damaging	0.98
R1665:Ryr1	UTSW	7	29036078	missense	probably damaging	1.00
R1678:Ryr1	UTSW	7	29116154	missense	probably damaging	0.99
R1705:Ryr1	UTSW	7	29078564	missense	probably damaging	1.00
R1712:Ryr1	UTSW	7	29047503	missense	probably benign	0.25
R1720:Ryr1	UTSW	7	29101870	missense	probably damaging	0.99
R1799:Ryr1	UTSW	7	29067621	missense	probably damaging	1.00
R1847:Ryr1	UTSW	7	29079811	missense	probably benign	0.43
R1860:Ryr1	UTSW	7	29009552	missense	unknown
R1861:Ryr1	UTSW	7	29009552	missense	unknown
R1921:Ryr1	UTSW	7	29054944	missense	probably damaging	1.00
R1983:Ryr1	UTSW	7	29059472	missense	possibly damaging	0.74
R2043:Ryr1	UTSW	7	29059631	missense	probably damaging	0.99
R2089:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2091:Ryr1	UTSW	7	29086049	missense	probably damaging	1.00
R2105:Ryr1	UTSW	7	29090150	missense	probably damaging	0.99
R2175:Ryr1	UTSW	7	29068442	missense	probably damaging	1.00
R2259:Ryr1	UTSW	7	29019741	missense	unknown
R2291:Ryr1	UTSW	7	29098777	missense	probably damaging	1.00
R2351:Ryr1	UTSW	7	29075293	missense	probably benign	0.18
R2512:Ryr1	UTSW	7	29103542	missense	possibly damaging	0.64
R2571:Ryr1	UTSW	7	29009562	missense	unknown
R2571:Ryr1	UTSW	7	29036126	missense	possibly damaging	0.94
R2885:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2886:Ryr1	UTSW	7	29074798	missense	probably damaging	0.99
R2889:Ryr1	UTSW	7	29078741	missense	possibly damaging	0.76
R3051:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3052:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3053:Ryr1	UTSW	7	29053090	missense	probably damaging	1.00
R3082:Ryr1	UTSW	7	29045646	missense	probably damaging	1.00
R3103:Ryr1	UTSW	7	29074948	missense	probably damaging	1.00
R3237:Ryr1	UTSW	7	29069650	critical splice acceptor site	probably null
R3551:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3552:Ryr1	UTSW	7	29056997	missense	probably damaging	1.00
R3807:Ryr1	UTSW	7	29020152	missense	probably damaging	1.00
R3815:Ryr1	UTSW	7	29072902	missense	probably damaging	0.98
R4010:Ryr1	UTSW	7	29095124	missense	probably benign	0.41
R4041:Ryr1	UTSW	7	29085931	missense	possibly damaging	0.77
R4226:Ryr1	UTSW	7	29062151	nonsense	probably null
R4257:Ryr1	UTSW	7	29082450	missense	possibly damaging	0.93
R4328:Ryr1	UTSW	7	29083059	missense	probably damaging	1.00
R4394:Ryr1	UTSW	7	29094242	missense	possibly damaging	0.69
R4485:Ryr1	UTSW	7	29090156	missense	probably damaging	0.97
R4550:Ryr1	UTSW	7	29098735	missense	probably benign	0.05
R4554:Ryr1	UTSW	7	29105008	missense	probably benign	0.03
R4562:Ryr1	UTSW	7	29074580	intron	probably benign
R4642:Ryr1	UTSW	7	29086038	missense	possibly damaging	0.91
R4669:Ryr1	UTSW	7	29059831	missense	probably null	0.99
R4707:Ryr1	UTSW	7	29045662	missense	probably damaging	1.00
R4766:Ryr1	UTSW	7	29085833	missense	probably damaging	0.96
R4768:Ryr1	UTSW	7	29004821	unclassified	probably benign
R4770:Ryr1	UTSW	7	29109282	missense	probably damaging	0.99
R4780:Ryr1	UTSW	7	29095097	missense	possibly damaging	0.85
R4927:Ryr1	UTSW	7	29019983	missense	unknown
R4933:Ryr1	UTSW	7	29104298	missense	probably damaging	1.00
R4934:Ryr1	UTSW	7	29068095	missense	probably damaging	1.00
R4942:Ryr1	UTSW	7	29069573	missense	probably damaging	0.98
R4960:Ryr1	UTSW	7	29078783	missense	possibly damaging	0.82
R5007:Ryr1	UTSW	7	29069115	missense	probably damaging	1.00
R5011:Ryr1	UTSW	7	29102809	splice site	probably null
R5013:Ryr1	UTSW	7	29102809	splice site	probably null
R5137:Ryr1	UTSW	7	29101858	missense	possibly damaging	0.94
R5167:Ryr1	UTSW	7	29067693	missense	probably damaging	1.00
R5239:Ryr1	UTSW	7	29036128	missense	probably damaging	1.00
R5291:Ryr1	UTSW	7	29115598	missense	probably benign	0.03
R5303:Ryr1	UTSW	7	29068482	missense	probably damaging	1.00
R5386:Ryr1	UTSW	7	29117416	missense	probably damaging	0.98
R5431:Ryr1	UTSW	7	29109812	missense	probably benign	0.39
R5460:Ryr1	UTSW	7	29071961	missense	probably damaging	1.00
R5463:Ryr1	UTSW	7	29024023	missense	possibly damaging	0.79
R5503:Ryr1	UTSW	7	29069028	missense	possibly damaging	0.87
R5541:Ryr1	UTSW	7	29086185	missense	probably damaging	1.00
R5573:Ryr1	UTSW	7	29015723	missense	unknown
R5575:Ryr1	UTSW	7	29078693	missense	possibly damaging	0.77
R5610:Ryr1	UTSW	7	29111974	missense	probably benign	0.05
R5658:Ryr1	UTSW	7	29091089	splice site	probably null
R5918:Ryr1	UTSW	7	29009152	missense	probably benign	0.39
R5926:Ryr1	UTSW	7	29104360	missense	probably damaging	1.00
R5938:Ryr1	UTSW	7	29046865	missense	probably damaging	1.00
R5939:Ryr1	UTSW	7	29116127	missense	probably damaging	0.97
R5947:Ryr1	UTSW	7	29071924	missense	probably null	0.98
R5991:Ryr1	UTSW	7	29104610	missense	probably damaging	0.99
R5992:Ryr1	UTSW	7	29067637	missense	probably damaging	1.00
R5996:Ryr1	UTSW	7	29024241	missense	probably benign	0.38
R6075:Ryr1	UTSW	7	29087438	missense	probably damaging	1.00
R6091:Ryr1	UTSW	7	29071973	missense	probably benign	0.01
R6126:Ryr1	UTSW	7	29076239	missense	probably null	1.00
R6147:Ryr1	UTSW	7	29085914	missense	possibly damaging	0.88
R6235:Ryr1	UTSW	7	29116181	missense	probably benign	0.07
R6279:Ryr1	UTSW	7	29087428	missense	possibly damaging	0.93
R6381:Ryr1	UTSW	7	29075257	missense	possibly damaging	0.87
R6441:Ryr1	UTSW	7	29059695	missense	possibly damaging	0.95
R6443:Ryr1	UTSW	7	29077078	missense	probably damaging	0.97
R6459:Ryr1	UTSW	7	29015654	missense	probably benign	0.39
R6514:Ryr1	UTSW	7	29046841	missense	probably damaging	1.00
R6563:Ryr1	UTSW	7	29095492	missense	possibly damaging	0.92
R6660:Ryr1	UTSW	7	29038345	critical splice donor site	probably null
R6746:Ryr1	UTSW	7	29117404	missense	possibly damaging	0.56
R6785:Ryr1	UTSW	7	29064874	missense	probably benign	0.12
R6800:Ryr1	UTSW	7	29024316	missense	possibly damaging	0.95
R6939:Ryr1	UTSW	7	29052326	missense	possibly damaging	0.91
R6980:Ryr1	UTSW	7	29109387	missense	probably benign	0.03
R6995:Ryr1	UTSW	7	29094182	missense	probably damaging	0.97
R7065:Ryr1	UTSW	7	29103643	missense	probably damaging	1.00
R7123:Ryr1	UTSW	7	29046854	missense	probably benign	0.37
R7238:Ryr1	UTSW	7	29095382	missense	probably benign	0.24
R7240:Ryr1	UTSW	7	29052015	missense	possibly damaging	0.95
R7300:Ryr1	UTSW	7	29059511	missense	probably damaging	1.00
R7365:Ryr1	UTSW	7	29085755	missense	probably benign	0.05
R7403:Ryr1	UTSW	7	29013867	missense	probably benign	0.34
R7422:Ryr1	UTSW	7	29085870	missense	probably benign	0.00
R7493:Ryr1	UTSW	7	29095205	missense	probably benign	0.44
R7570:Ryr1	UTSW	7	29078585	missense	probably damaging	0.98
R7593:Ryr1	UTSW	7	29036103	missense	probably damaging	1.00
R7769:Ryr1	UTSW	7	29098785	missense	probably damaging	1.00
R7781:Ryr1	UTSW	7	29067630	missense	probably damaging	1.00
R7790:Ryr1	UTSW	7	29104832	missense	probably benign	0.39
R7799:Ryr1	UTSW	7	29003560	splice site	probably null
R7916:Ryr1	UTSW	7	29090939	nonsense	probably null
R7922:Ryr1	UTSW	7	29097224	missense	probably benign	0.09
R7988:Ryr1	UTSW	7	29096171	missense	probably benign	0.29
R7997:Ryr1	UTSW	7	29003543	missense	unknown
R8052:Ryr1	UTSW	7	29083385	missense	probably benign	0.05
R8096:Ryr1	UTSW	7	29009201	missense	unknown
R8116:Ryr1	UTSW	7	29110883	missense	probably benign	0.03
R8202:Ryr1	UTSW	7	29091032	missense	probably benign	0.18
R8207:Ryr1	UTSW	7	29090225	missense	probably damaging	1.00
R8248:Ryr1	UTSW	7	29069121	missense	probably damaging	1.00
R8257:Ryr1	UTSW	7	29064639	missense	possibly damaging	0.82
R8354:Ryr1	UTSW	7	29015717	missense	unknown
R8454:Ryr1	UTSW	7	29015717	missense	unknown
R8487:Ryr1	UTSW	7	29040867	missense	probably damaging	0.97
R8529:Ryr1	UTSW	7	29070084	missense	possibly damaging	0.86
R8545:Ryr1	UTSW	7	29004814	unclassified	probably benign
R8678:Ryr1	UTSW	7	29077064	missense	probably damaging	0.99
R8717:Ryr1	UTSW	7	29052328	missense	probably benign	0.03
R8724:Ryr1	UTSW	7	29117377	missense	probably benign	0.04
R8755:Ryr1	UTSW	7	29092268	missense	probably benign	0.19
R8772:Ryr1	UTSW	7	29116132	missense	probably benign	0.05
R8790:Ryr1	UTSW	7	29076872	missense	probably damaging	1.00
R8793:Ryr1	UTSW	7	29064859	missense	probably damaging	1.00
R8836:Ryr1	UTSW	7	29074666	missense	probably damaging	1.00
R8858:Ryr1	UTSW	7	29109213	missense	probably benign	0.00
R8910:Ryr1	UTSW	7	29071915	missense	probably damaging	1.00
R8920:Ryr1	UTSW	7	29090215	missense	possibly damaging	0.89
R8938:Ryr1	UTSW	7	29101933	missense	probably damaging	1.00
R9035:Ryr1	UTSW	7	29090997	missense	probably damaging	0.97
R9115:Ryr1	UTSW	7	29104564	nonsense	probably null
R9123:Ryr1	UTSW	7	29071804	missense	probably damaging	1.00
R9154:Ryr1	UTSW	7	29069858	missense	probably benign	0.08
R9189:Ryr1	UTSW	7	29077046	missense	probably damaging	1.00
R9200:Ryr1	UTSW	7	29095099	missense	probably benign	0.00
R9214:Ryr1	UTSW	7	29085762	missense	possibly damaging	0.52
R9216:Ryr1	UTSW	7	29101852	missense	probably damaging	0.97
R9240:Ryr1	UTSW	7	29043888	missense	probably damaging	1.00
R9261:Ryr1	UTSW	7	29052388	missense	possibly damaging	0.91
R9276:Ryr1	UTSW	7	29102829	missense	probably damaging	0.99
R9280:Ryr1	UTSW	7	29102964	missense	probably damaging	1.00
R9316:Ryr1	UTSW	7	29017962	missense	unknown
R9333:Ryr1	UTSW	7	29074789	critical splice donor site	probably null
R9459:Ryr1	UTSW	7	29068643	missense	probably damaging	1.00
R9468:Ryr1	UTSW	7	29073085	missense	probably damaging	1.00
R9486:Ryr1	UTSW	7	29078540	missense	probably benign	0.15
R9524:Ryr1	UTSW	7	29024175	missense	probably damaging	1.00
R9620:Ryr1	UTSW	7	29015713	missense	unknown
R9664:Ryr1	UTSW	7	29059667	missense	probably damaging	1.00
R9776:Ryr1	UTSW	7	29075239	missense	probably damaging	1.00
X0021:Ryr1	UTSW	7	29061531	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29020214	missense	probably damaging	1.00
Z1176:Ryr1	UTSW	7	29086035	missense	probably benign	0.10
Z1176:Ryr1	UTSW	7	29103498	missense	probably damaging	1.00
Z1177:Ryr1	UTSW	7	29017985	missense	unknown
Z1177:Ryr1	UTSW	7	29048792	nonsense	probably null
Z1177:Ryr1	UTSW	7	29101922	missense	probably damaging	1.00
Z1186:Ryr1	UTSW	7	29082477	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- GTAGCCCGAACCTCACTTTGATCTG -3'
(R):5'- CGCTAATAAGCGTACCATCCTTCCC -3'

Sequencing Primer
(F):5'- actccatctgctttcgcc -3'
(R):5'- AAGCGTACCATCCTTCCCTTATTAG -3'

Posted On

2014-04-13