Incidental Mutation 'R1513:Or52d1'
ID 168526
Institutional Source Beutler Lab
Gene Symbol Or52d1
Ensembl Gene ENSMUSG00000073931
Gene Name olfactory receptor family 52 subfamily D member 1
Synonyms Olfr646, MOR33-2, GA_x6K02T2PBJ9-6841330-6842268
MMRRC Submission 039560-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R1513 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103754080-103758973 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103755671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 62 (L62F)
Ref Sequence ENSEMBL: ENSMUSP00000149102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098182] [ENSMUST00000138055] [ENSMUST00000214099]
AlphaFold Q8VGW2
Predicted Effect probably benign
Transcript: ENSMUST00000098182
AA Change: L62F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095784
Gene: ENSMUSG00000073931
AA Change: L62F

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.9e-109 PFAM
Pfam:7TM_GPCR_Srsx 32 225 6.1e-10 PFAM
Pfam:7tm_1 38 290 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214099
AA Change: L62F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214291
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,947,334 (GRCm39) C64* probably null Het
1700003H04Rik A C 3: 124,368,985 (GRCm39) Y109D possibly damaging Het
Abca15 A T 7: 119,939,322 (GRCm39) I239F probably damaging Het
Adgrv1 A G 13: 81,741,167 (GRCm39) V99A probably damaging Het
Adgrv1 A T 13: 81,705,076 (GRCm39) I1578K probably damaging Het
Ap4e1 G T 2: 126,903,475 (GRCm39) K792N probably null Het
Ap5b1 G A 19: 5,619,892 (GRCm39) W437* probably null Het
Arhgef17 A G 7: 100,580,069 (GRCm39) L293P probably benign Het
Arhgef33 A C 17: 80,678,818 (GRCm39) M505L probably benign Het
Arih1 T A 9: 59,310,663 (GRCm39) R320S probably damaging Het
Atp1b3 A T 9: 96,246,206 (GRCm39) M1K probably null Het
Bbs2 T C 8: 94,816,472 (GRCm39) D130G possibly damaging Het
Bscl2 G A 19: 8,818,509 (GRCm39) R38H probably damaging Het
Cad A G 5: 31,226,106 (GRCm39) Y1102C probably damaging Het
Cc2d1b G A 4: 108,490,423 (GRCm39) R825Q probably damaging Het
Ccdc39 A G 3: 33,893,294 (GRCm39) V97A possibly damaging Het
Ccr1 T C 9: 123,764,510 (GRCm39) T7A probably benign Het
Cd33 A G 7: 43,181,618 (GRCm39) S181P probably damaging Het
Cdc20 A C 4: 118,290,304 (GRCm39) S452R probably damaging Het
Cdk8 A T 5: 146,233,188 (GRCm39) I229F possibly damaging Het
Ces3a A T 8: 105,776,909 (GRCm39) N131Y probably damaging Het
Cgnl1 A G 9: 71,631,872 (GRCm39) I493T probably benign Het
Chia1 G A 3: 106,039,220 (GRCm39) V437M probably benign Het
Chrna2 G A 14: 66,380,878 (GRCm39) R49H probably benign Het
Clec12b A G 6: 129,353,265 (GRCm39) C241R probably damaging Het
Col11a1 A G 3: 113,890,803 (GRCm39) D380G unknown Het
Crebbp A G 16: 3,933,749 (GRCm39) S948P probably damaging Het
Dchs1 G A 7: 105,421,278 (GRCm39) R381* probably null Het
Defb19 A T 2: 152,418,085 (GRCm39) *84R probably null Het
Dnah8 T C 17: 30,892,862 (GRCm39) F816L probably benign Het
Dync2h1 T A 9: 7,103,663 (GRCm39) I371F possibly damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fggy T C 4: 95,790,295 (GRCm39) probably benign Het
Galnt12 G A 4: 47,117,956 (GRCm39) C125Y probably damaging Het
Gm4952 A T 19: 12,602,039 (GRCm39) D149V probably damaging Het
Gm6309 A T 5: 146,107,393 (GRCm39) H37Q possibly damaging Het
Gmnn A G 13: 24,940,615 (GRCm39) L78P possibly damaging Het
Golga4 C A 9: 118,384,800 (GRCm39) Q613K probably benign Het
Iqgap2 A T 13: 95,766,518 (GRCm39) I1495K probably damaging Het
Junb T C 8: 85,704,758 (GRCm39) T101A probably damaging Het
Kif21b T C 1: 136,083,849 (GRCm39) Y699H probably damaging Het
Klf17 T C 4: 117,618,132 (GRCm39) E75G probably damaging Het
Klra17 T C 6: 129,849,277 (GRCm39) E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,451,672 (GRCm39) probably benign Het
Krt87 C T 15: 101,387,538 (GRCm39) V167M probably benign Het
Lce1m A G 3: 92,925,932 (GRCm39) probably benign Het
Lpin3 A T 2: 160,746,468 (GRCm39) Y709F probably damaging Het
Ltbp2 T A 12: 84,838,718 (GRCm39) D1080V probably damaging Het
Mycbp2 G A 14: 103,441,825 (GRCm39) T1980I probably damaging Het
Myo1g T A 11: 6,465,140 (GRCm39) K435M probably damaging Het
Mypn T A 10: 63,005,147 (GRCm39) N320I probably damaging Het
Naip5 A T 13: 100,358,714 (GRCm39) W841R probably benign Het
Ncapd2 A T 6: 125,147,955 (GRCm39) M1124K probably damaging Het
Ncf4 A G 15: 78,146,560 (GRCm39) D330G probably benign Het
Ndst3 C T 3: 123,395,104 (GRCm39) V509M possibly damaging Het
Neb A T 2: 52,117,256 (GRCm39) D4105E probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nsrp1 A T 11: 76,937,445 (GRCm39) F250L probably benign Het
Or11g7 A G 14: 50,691,138 (GRCm39) I210V probably benign Het
Or4l15 T C 14: 50,198,558 (GRCm39) probably null Het
Or52k2 G T 7: 102,254,509 (GRCm39) G316V probably benign Het
Or5m12 A T 2: 85,735,015 (GRCm39) Y128N probably damaging Het
Or8k3b C T 2: 86,521,141 (GRCm39) M59I possibly damaging Het
Oxr1 A G 15: 41,660,870 (GRCm39) D67G probably damaging Het
P2ry12 A T 3: 59,125,498 (GRCm39) I59N probably damaging Het
Pcdhb12 G T 18: 37,570,111 (GRCm39) G419V probably damaging Het
Pdzd2 G T 15: 12,373,915 (GRCm39) S2073R possibly damaging Het
Pex5l C A 3: 33,069,162 (GRCm39) E112* probably null Het
Plaur A G 7: 24,172,016 (GRCm39) D163G probably benign Het
Plk2 A G 13: 110,536,622 (GRCm39) Y638C probably benign Het
Ppp1r15b A G 1: 133,061,088 (GRCm39) N535S probably benign Het
Ppp2r1b T C 9: 50,781,445 (GRCm39) L21P probably damaging Het
Prkar2a G A 9: 108,605,469 (GRCm39) V176I possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rag1 A G 2: 101,473,336 (GRCm39) M602T possibly damaging Het
Rb1 A G 14: 73,559,524 (GRCm39) V60A probably benign Het
Rgs20 T A 1: 4,982,560 (GRCm39) I303F probably damaging Het
Rnf43 T A 11: 87,620,257 (GRCm39) I240N probably damaging Het
Romo1 G A 2: 155,986,433 (GRCm39) V19M probably benign Het
Ryr1 A G 7: 28,770,046 (GRCm39) S2676P probably damaging Het
Ryr3 G A 2: 112,539,542 (GRCm39) Q3233* probably null Het
Skic2 G T 17: 35,066,420 (GRCm39) P188T probably damaging Het
Slc26a6 A G 9: 108,733,035 (GRCm39) R5G probably benign Het
Slc33a1 A G 3: 63,871,376 (GRCm39) L79P probably damaging Het
Snx31 G A 15: 36,545,745 (GRCm39) R91C probably damaging Het
Tecpr2 T C 12: 110,921,234 (GRCm39) I1269T possibly damaging Het
Tjap1 G T 17: 46,572,368 (GRCm39) D89E probably benign Het
Tmem53 A T 4: 117,123,090 (GRCm39) Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 (GRCm39) V95F possibly damaging Het
Trim30c A C 7: 104,031,896 (GRCm39) H306Q probably benign Het
Trpm3 A T 19: 22,964,236 (GRCm39) M1244L possibly damaging Het
Tspan32 A G 7: 142,558,886 (GRCm39) I14V probably null Het
Ube4b A G 4: 149,436,035 (GRCm39) V695A probably benign Het
Ubxn11 G A 4: 133,851,452 (GRCm39) probably null Het
Ugt3a1 A G 15: 9,361,610 (GRCm39) I129V probably benign Het
Vmn1r45 A G 6: 89,910,058 (GRCm39) V304A probably damaging Het
Vmn2r124 A T 17: 18,283,535 (GRCm39) S410C probably damaging Het
Vmn2r15 T A 5: 109,441,195 (GRCm39) D221V probably damaging Het
Vmn2r79 G A 7: 86,686,652 (GRCm39) V678I probably benign Het
Vps13b A T 15: 35,438,876 (GRCm39) R319* probably null Het
Wdr95 G A 5: 149,522,759 (GRCm39) R639Q probably benign Het
Xirp2 A G 2: 67,341,874 (GRCm39) I1372V probably benign Het
Xpo5 T A 17: 46,537,906 (GRCm39) M611K probably benign Het
Zfat A G 15: 68,084,529 (GRCm39) C121R probably damaging Het
Zfp382 A T 7: 29,832,721 (GRCm39) Y124F probably benign Het
Zfp512b A G 2: 181,230,982 (GRCm39) F371S probably benign Het
Zfy2 A G Y: 2,116,185 (GRCm39) V285A probably benign Het
Other mutations in Or52d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Or52d1 APN 7 103,755,840 (GRCm39) missense probably damaging 1.00
IGL02454:Or52d1 APN 7 103,755,819 (GRCm39) missense probably damaging 0.96
IGL02588:Or52d1 APN 7 103,756,260 (GRCm39) missense possibly damaging 0.94
IGL02961:Or52d1 APN 7 103,756,357 (GRCm39) nonsense probably null
IGL03092:Or52d1 APN 7 103,755,854 (GRCm39) missense probably damaging 0.99
PIT4402001:Or52d1 UTSW 7 103,755,657 (GRCm39) missense probably damaging 1.00
R0006:Or52d1 UTSW 7 103,755,527 (GRCm39) missense probably benign 0.00
R0109:Or52d1 UTSW 7 103,755,812 (GRCm39) missense probably damaging 1.00
R0109:Or52d1 UTSW 7 103,755,812 (GRCm39) missense probably damaging 1.00
R0601:Or52d1 UTSW 7 103,756,349 (GRCm39) missense possibly damaging 0.83
R0732:Or52d1 UTSW 7 103,755,501 (GRCm39) missense probably damaging 1.00
R1320:Or52d1 UTSW 7 103,755,687 (GRCm39) missense probably damaging 1.00
R1468:Or52d1 UTSW 7 103,755,896 (GRCm39) missense possibly damaging 0.82
R1468:Or52d1 UTSW 7 103,755,896 (GRCm39) missense possibly damaging 0.82
R5486:Or52d1 UTSW 7 103,755,705 (GRCm39) missense probably damaging 0.99
R6110:Or52d1 UTSW 7 103,755,779 (GRCm39) missense probably damaging 1.00
R6497:Or52d1 UTSW 7 103,756,422 (GRCm39) intron probably benign
R6856:Or52d1 UTSW 7 103,755,998 (GRCm39) missense probably benign 0.00
R7766:Or52d1 UTSW 7 103,756,201 (GRCm39) nonsense probably null
R7789:Or52d1 UTSW 7 103,756,195 (GRCm39) missense probably damaging 0.99
R7844:Or52d1 UTSW 7 103,755,690 (GRCm39) missense probably damaging 1.00
R8888:Or52d1 UTSW 7 103,756,302 (GRCm39) missense probably damaging 1.00
R8895:Or52d1 UTSW 7 103,756,302 (GRCm39) missense probably damaging 1.00
R9167:Or52d1 UTSW 7 103,756,426 (GRCm39) makesense probably null
R9178:Or52d1 UTSW 7 103,755,720 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCGAAAGTCTCCCAGTCACTCTC -3'
(R):5'- GCCTAGCAATGCCCATATGCTCAC -3'

Sequencing Primer
(F):5'- CAGTCACTCTCTTCCTAACTGG -3'
(R):5'- TCCCAGCAAAGATAATTTGGGC -3'
Posted On 2014-04-13