Incidental Mutation 'R1513:Naip5'
ID 168557
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Lgn1, Naip-rs3
MMRRC Submission 039560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1513 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100211739-100246323 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100222206 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 841 (W841R)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably benign
Transcript: ENSMUST00000049789
AA Change: W841R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: W841R

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,809,273 C64* probably null Het
1700003H04Rik A C 3: 124,575,336 Y109D possibly damaging Het
Abca15 A T 7: 120,340,099 I239F probably damaging Het
Adgrv1 A T 13: 81,556,957 I1578K probably damaging Het
Adgrv1 A G 13: 81,593,048 V99A probably damaging Het
Ap4e1 G T 2: 127,061,555 K792N probably null Het
Ap5b1 G A 19: 5,569,864 W437* probably null Het
Arhgef17 A G 7: 100,930,862 L293P probably benign Het
Arhgef33 A C 17: 80,371,389 M505L probably benign Het
Arih1 T A 9: 59,403,380 R320S probably damaging Het
Atp1b3 A T 9: 96,364,153 M1K probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Bbs2 T C 8: 94,089,844 D130G possibly damaging Het
Bscl2 G A 19: 8,841,145 R38H probably damaging Het
Cad A G 5: 31,068,762 Y1102C probably damaging Het
Cc2d1b G A 4: 108,633,226 R825Q probably damaging Het
Ccdc39 A G 3: 33,839,145 V97A possibly damaging Het
Ccr1 T C 9: 123,964,473 T7A probably benign Het
Cd33 A G 7: 43,532,194 S181P probably damaging Het
Cdc20 A C 4: 118,433,107 S452R probably damaging Het
Cdk8 A T 5: 146,296,378 I229F possibly damaging Het
Ces3a A T 8: 105,050,277 N131Y probably damaging Het
Cgnl1 A G 9: 71,724,590 I493T probably benign Het
Chia1 G A 3: 106,131,904 V437M probably benign Het
Chrna2 G A 14: 66,143,429 R49H probably benign Het
Clec12b A G 6: 129,376,302 C241R probably damaging Het
Col11a1 A G 3: 114,097,154 D380G unknown Het
Crebbp A G 16: 4,115,885 S948P probably damaging Het
Dchs1 G A 7: 105,772,071 R381* probably null Het
Defb19 A T 2: 152,576,165 *84R probably null Het
Dnah8 T C 17: 30,673,888 F816L probably benign Het
Dync2h1 T A 9: 7,103,663 I371F possibly damaging Het
Fggy T C 4: 95,902,058 probably benign Het
Galnt12 G A 4: 47,117,956 C125Y probably damaging Het
Gm4952 A T 19: 12,624,675 D149V probably damaging Het
Gm6309 A T 5: 146,170,583 H37Q possibly damaging Het
Gmnn A G 13: 24,756,632 L78P possibly damaging Het
Golga4 C A 9: 118,555,732 Q613K probably benign Het
Iqgap2 A T 13: 95,630,010 I1495K probably damaging Het
Junb T C 8: 84,978,129 T101A probably damaging Het
Kif21b T C 1: 136,156,111 Y699H probably damaging Het
Klf17 T C 4: 117,760,935 E75G probably damaging Het
Klra17 T C 6: 129,872,314 E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,852,449 probably benign Het
Krt83 C T 15: 101,489,657 V167M probably benign Het
Lce1m A G 3: 93,018,625 probably benign Het
Lpin3 A T 2: 160,904,548 Y709F probably damaging Het
Ltbp2 T A 12: 84,791,944 D1080V probably damaging Het
Mycbp2 G A 14: 103,204,389 T1980I probably damaging Het
Myo1g T A 11: 6,515,140 K435M probably damaging Het
Mypn T A 10: 63,169,368 N320I probably damaging Het
Ncapd2 A T 6: 125,170,992 M1124K probably damaging Het
Ncf4 A G 15: 78,262,360 D330G probably benign Het
Ndst3 C T 3: 123,601,455 V509M possibly damaging Het
Neb A T 2: 52,227,244 D4105E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nsrp1 A T 11: 77,046,619 F250L probably benign Het
Olfr1024 A T 2: 85,904,671 Y128N probably damaging Het
Olfr1087 C T 2: 86,690,797 M59I possibly damaging Het
Olfr552 G T 7: 102,605,302 G316V probably benign Het
Olfr646 C T 7: 104,106,464 L62F probably benign Het
Olfr724 T C 14: 49,961,101 probably null Het
Olfr740 A G 14: 50,453,681 I210V probably benign Het
Oxr1 A G 15: 41,797,474 D67G probably damaging Het
P2ry12 A T 3: 59,218,077 I59N probably damaging Het
Pcdhb12 G T 18: 37,437,058 G419V probably damaging Het
Pdzd2 G T 15: 12,373,829 S2073R possibly damaging Het
Pex5l C A 3: 33,015,013 E112* probably null Het
Plaur A G 7: 24,472,591 D163G probably benign Het
Plk2 A G 13: 110,400,088 Y638C probably benign Het
Ppp1r15b A G 1: 133,133,350 N535S probably benign Het
Ppp2r1b T C 9: 50,870,145 L21P probably damaging Het
Prkar2a G A 9: 108,728,270 V176I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rag1 A G 2: 101,642,991 M602T possibly damaging Het
Rb1 A G 14: 73,322,084 V60A probably benign Het
Rgs20 T A 1: 4,912,337 I303F probably damaging Het
Rnf43 T A 11: 87,729,431 I240N probably damaging Het
Romo1 G A 2: 156,144,513 V19M probably benign Het
Ryr1 A G 7: 29,070,621 S2676P probably damaging Het
Ryr3 G A 2: 112,709,197 Q3233* probably null Het
Skiv2l G T 17: 34,847,444 P188T probably damaging Het
Slc26a6 A G 9: 108,855,836 R5G probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Snx31 G A 15: 36,545,600 R91C probably damaging Het
Tecpr2 T C 12: 110,954,800 I1269T possibly damaging Het
Tjap1 G T 17: 46,261,442 D89E probably benign Het
Tmem53 A T 4: 117,265,893 Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 V95F possibly damaging Het
Trim30c A C 7: 104,382,689 H306Q probably benign Het
Trpm3 A T 19: 22,986,872 M1244L possibly damaging Het
Tspan32 A G 7: 143,005,149 I14V probably null Het
Ube4b A G 4: 149,351,578 V695A probably benign Het
Ubxn11 G A 4: 134,124,141 probably null Het
Ugt3a2 A G 15: 9,361,524 I129V probably benign Het
Vmn1r45 A G 6: 89,933,076 V304A probably damaging Het
Vmn2r124 A T 17: 18,063,273 S410C probably damaging Het
Vmn2r15 T A 5: 109,293,329 D221V probably damaging Het
Vmn2r79 G A 7: 87,037,444 V678I probably benign Het
Vps13b A T 15: 35,438,730 R319* probably null Het
Wdr95 G A 5: 149,599,294 R639Q probably benign Het
Xirp2 A G 2: 67,511,530 I1372V probably benign Het
Xpo5 T A 17: 46,226,980 M611K probably benign Het
Zfat A G 15: 68,212,680 C121R probably damaging Het
Zfp382 A T 7: 30,133,296 Y124F probably benign Het
Zfp512b A G 2: 181,589,189 F371S probably benign Het
Zfy2 A G Y: 2,116,185 V285A probably benign Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100223096 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
R8833:Naip5 UTSW 13 100222934 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100219830 missense probably benign
R8958:Naip5 UTSW 13 100217609 nonsense probably null
R9031:Naip5 UTSW 13 100219830 missense probably benign
R9032:Naip5 UTSW 13 100219830 missense probably benign
R9074:Naip5 UTSW 13 100221756 missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100229619 missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100222500 missense probably damaging 1.00
R9223:Naip5 UTSW 13 100227676 missense probably benign 0.05
R9358:Naip5 UTSW 13 100219830 missense probably benign
R9389:Naip5 UTSW 13 100219830 missense probably benign
R9403:Naip5 UTSW 13 100219830 missense probably benign
R9518:Naip5 UTSW 13 100221859 missense probably benign
R9568:Naip5 UTSW 13 100219830 missense probably benign
R9568:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9569:Naip5 UTSW 13 100219830 missense probably benign
R9569:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9570:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9572:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9581:Naip5 UTSW 13 100214686 missense probably benign 0.11
R9627:Naip5 UTSW 13 100219830 missense probably benign
R9725:Naip5 UTSW 13 100222276 missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9764:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9765:Naip5 UTSW 13 100230761 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGACTTCCATGAGGACCTGGAGC -3'
(R):5'- GACAAATCGACTCACCTCTGAAGGC -3'

Sequencing Primer
(F):5'- CTCAACAGTAACAGGCTTTCTGG -3'
(R):5'- CTCTGAAGGCAATAAACTCCTTTAAC -3'
Posted On 2014-04-13