Incidental Mutation 'R1513:Skic2'
ID 168578
Institutional Source Beutler Lab
Gene Symbol Skic2
Ensembl Gene ENSMUSG00000040356
Gene Name SKI2 subunit of superkiller complex
Synonyms 4930534J06Rik, Ski2w, Skiv2l
MMRRC Submission 039560-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1513 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35058202-35069180 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 35066420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 188 (P188T)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000097343] [ENSMUST00000165953] [ENSMUST00000172966] [ENSMUST00000173357] [ENSMUST00000173415] [ENSMUST00000173065]
AlphaFold Q6NZR5
Predicted Effect probably damaging
Transcript: ENSMUST00000046022
AA Change: P188T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: P188T

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097343
SMART Domains Protein: ENSMUSP00000094956
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165953
SMART Domains Protein: ENSMUSP00000131195
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172878
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect probably benign
Transcript: ENSMUST00000173357
SMART Domains Protein: ENSMUSP00000134272
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 239 N/A INTRINSIC
RRM 259 324 7.25e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173415
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173065
SMART Domains Protein: ENSMUSP00000133934
Gene: ENSMUSG00000024369

DomainStartEndE-ValueType
coiled coil region 7 36 N/A INTRINSIC
low complexity region 147 167 N/A INTRINSIC
low complexity region 184 228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A T 5: 114,947,334 (GRCm39) C64* probably null Het
1700003H04Rik A C 3: 124,368,985 (GRCm39) Y109D possibly damaging Het
Abca15 A T 7: 119,939,322 (GRCm39) I239F probably damaging Het
Adgrv1 A G 13: 81,741,167 (GRCm39) V99A probably damaging Het
Adgrv1 A T 13: 81,705,076 (GRCm39) I1578K probably damaging Het
Ap4e1 G T 2: 126,903,475 (GRCm39) K792N probably null Het
Ap5b1 G A 19: 5,619,892 (GRCm39) W437* probably null Het
Arhgef17 A G 7: 100,580,069 (GRCm39) L293P probably benign Het
Arhgef33 A C 17: 80,678,818 (GRCm39) M505L probably benign Het
Arih1 T A 9: 59,310,663 (GRCm39) R320S probably damaging Het
Atp1b3 A T 9: 96,246,206 (GRCm39) M1K probably null Het
Bbs2 T C 8: 94,816,472 (GRCm39) D130G possibly damaging Het
Bscl2 G A 19: 8,818,509 (GRCm39) R38H probably damaging Het
Cad A G 5: 31,226,106 (GRCm39) Y1102C probably damaging Het
Cc2d1b G A 4: 108,490,423 (GRCm39) R825Q probably damaging Het
Ccdc39 A G 3: 33,893,294 (GRCm39) V97A possibly damaging Het
Ccr1 T C 9: 123,764,510 (GRCm39) T7A probably benign Het
Cd33 A G 7: 43,181,618 (GRCm39) S181P probably damaging Het
Cdc20 A C 4: 118,290,304 (GRCm39) S452R probably damaging Het
Cdk8 A T 5: 146,233,188 (GRCm39) I229F possibly damaging Het
Ces3a A T 8: 105,776,909 (GRCm39) N131Y probably damaging Het
Cgnl1 A G 9: 71,631,872 (GRCm39) I493T probably benign Het
Chia1 G A 3: 106,039,220 (GRCm39) V437M probably benign Het
Chrna2 G A 14: 66,380,878 (GRCm39) R49H probably benign Het
Clec12b A G 6: 129,353,265 (GRCm39) C241R probably damaging Het
Col11a1 A G 3: 113,890,803 (GRCm39) D380G unknown Het
Crebbp A G 16: 3,933,749 (GRCm39) S948P probably damaging Het
Dchs1 G A 7: 105,421,278 (GRCm39) R381* probably null Het
Defb19 A T 2: 152,418,085 (GRCm39) *84R probably null Het
Dnah8 T C 17: 30,892,862 (GRCm39) F816L probably benign Het
Dync2h1 T A 9: 7,103,663 (GRCm39) I371F possibly damaging Het
Ezhip GTCATCATCATCATC GTCATCATCATCATCATC X: 5,994,645 (GRCm39) probably benign Het
Fggy T C 4: 95,790,295 (GRCm39) probably benign Het
Galnt12 G A 4: 47,117,956 (GRCm39) C125Y probably damaging Het
Gm4952 A T 19: 12,602,039 (GRCm39) D149V probably damaging Het
Gm6309 A T 5: 146,107,393 (GRCm39) H37Q possibly damaging Het
Gmnn A G 13: 24,940,615 (GRCm39) L78P possibly damaging Het
Golga4 C A 9: 118,384,800 (GRCm39) Q613K probably benign Het
Iqgap2 A T 13: 95,766,518 (GRCm39) I1495K probably damaging Het
Junb T C 8: 85,704,758 (GRCm39) T101A probably damaging Het
Kif21b T C 1: 136,083,849 (GRCm39) Y699H probably damaging Het
Klf17 T C 4: 117,618,132 (GRCm39) E75G probably damaging Het
Klra17 T C 6: 129,849,277 (GRCm39) E99G possibly damaging Het
Knop1 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 7: 118,451,672 (GRCm39) probably benign Het
Krt87 C T 15: 101,387,538 (GRCm39) V167M probably benign Het
Lce1m A G 3: 92,925,932 (GRCm39) probably benign Het
Lpin3 A T 2: 160,746,468 (GRCm39) Y709F probably damaging Het
Ltbp2 T A 12: 84,838,718 (GRCm39) D1080V probably damaging Het
Mycbp2 G A 14: 103,441,825 (GRCm39) T1980I probably damaging Het
Myo1g T A 11: 6,465,140 (GRCm39) K435M probably damaging Het
Mypn T A 10: 63,005,147 (GRCm39) N320I probably damaging Het
Naip5 A T 13: 100,358,714 (GRCm39) W841R probably benign Het
Ncapd2 A T 6: 125,147,955 (GRCm39) M1124K probably damaging Het
Ncf4 A G 15: 78,146,560 (GRCm39) D330G probably benign Het
Ndst3 C T 3: 123,395,104 (GRCm39) V509M possibly damaging Het
Neb A T 2: 52,117,256 (GRCm39) D4105E probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nsrp1 A T 11: 76,937,445 (GRCm39) F250L probably benign Het
Or11g7 A G 14: 50,691,138 (GRCm39) I210V probably benign Het
Or4l15 T C 14: 50,198,558 (GRCm39) probably null Het
Or52d1 C T 7: 103,755,671 (GRCm39) L62F probably benign Het
Or52k2 G T 7: 102,254,509 (GRCm39) G316V probably benign Het
Or5m12 A T 2: 85,735,015 (GRCm39) Y128N probably damaging Het
Or8k3b C T 2: 86,521,141 (GRCm39) M59I possibly damaging Het
Oxr1 A G 15: 41,660,870 (GRCm39) D67G probably damaging Het
P2ry12 A T 3: 59,125,498 (GRCm39) I59N probably damaging Het
Pcdhb12 G T 18: 37,570,111 (GRCm39) G419V probably damaging Het
Pdzd2 G T 15: 12,373,915 (GRCm39) S2073R possibly damaging Het
Pex5l C A 3: 33,069,162 (GRCm39) E112* probably null Het
Plaur A G 7: 24,172,016 (GRCm39) D163G probably benign Het
Plk2 A G 13: 110,536,622 (GRCm39) Y638C probably benign Het
Ppp1r15b A G 1: 133,061,088 (GRCm39) N535S probably benign Het
Ppp2r1b T C 9: 50,781,445 (GRCm39) L21P probably damaging Het
Prkar2a G A 9: 108,605,469 (GRCm39) V176I possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rag1 A G 2: 101,473,336 (GRCm39) M602T possibly damaging Het
Rb1 A G 14: 73,559,524 (GRCm39) V60A probably benign Het
Rgs20 T A 1: 4,982,560 (GRCm39) I303F probably damaging Het
Rnf43 T A 11: 87,620,257 (GRCm39) I240N probably damaging Het
Romo1 G A 2: 155,986,433 (GRCm39) V19M probably benign Het
Ryr1 A G 7: 28,770,046 (GRCm39) S2676P probably damaging Het
Ryr3 G A 2: 112,539,542 (GRCm39) Q3233* probably null Het
Slc26a6 A G 9: 108,733,035 (GRCm39) R5G probably benign Het
Slc33a1 A G 3: 63,871,376 (GRCm39) L79P probably damaging Het
Snx31 G A 15: 36,545,745 (GRCm39) R91C probably damaging Het
Tecpr2 T C 12: 110,921,234 (GRCm39) I1269T possibly damaging Het
Tjap1 G T 17: 46,572,368 (GRCm39) D89E probably benign Het
Tmem53 A T 4: 117,123,090 (GRCm39) Q39L probably damaging Het
Tmod1 G T 4: 46,083,549 (GRCm39) V95F possibly damaging Het
Trim30c A C 7: 104,031,896 (GRCm39) H306Q probably benign Het
Trpm3 A T 19: 22,964,236 (GRCm39) M1244L possibly damaging Het
Tspan32 A G 7: 142,558,886 (GRCm39) I14V probably null Het
Ube4b A G 4: 149,436,035 (GRCm39) V695A probably benign Het
Ubxn11 G A 4: 133,851,452 (GRCm39) probably null Het
Ugt3a1 A G 15: 9,361,610 (GRCm39) I129V probably benign Het
Vmn1r45 A G 6: 89,910,058 (GRCm39) V304A probably damaging Het
Vmn2r124 A T 17: 18,283,535 (GRCm39) S410C probably damaging Het
Vmn2r15 T A 5: 109,441,195 (GRCm39) D221V probably damaging Het
Vmn2r79 G A 7: 86,686,652 (GRCm39) V678I probably benign Het
Vps13b A T 15: 35,438,876 (GRCm39) R319* probably null Het
Wdr95 G A 5: 149,522,759 (GRCm39) R639Q probably benign Het
Xirp2 A G 2: 67,341,874 (GRCm39) I1372V probably benign Het
Xpo5 T A 17: 46,537,906 (GRCm39) M611K probably benign Het
Zfat A G 15: 68,084,529 (GRCm39) C121R probably damaging Het
Zfp382 A T 7: 29,832,721 (GRCm39) Y124F probably benign Het
Zfp512b A G 2: 181,230,982 (GRCm39) F371S probably benign Het
Zfy2 A G Y: 2,116,185 (GRCm39) V285A probably benign Het
Other mutations in Skic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skic2 APN 17 35,058,524 (GRCm39) missense probably damaging 1.00
IGL00338:Skic2 APN 17 35,065,643 (GRCm39) missense probably damaging 0.99
IGL01284:Skic2 APN 17 35,058,664 (GRCm39) unclassified probably benign
IGL01308:Skic2 APN 17 35,059,610 (GRCm39) missense probably benign 0.19
IGL01874:Skic2 APN 17 35,060,185 (GRCm39) missense probably benign
IGL02114:Skic2 APN 17 35,060,092 (GRCm39) missense probably damaging 0.97
IGL02208:Skic2 APN 17 35,060,651 (GRCm39) missense probably damaging 0.99
IGL02274:Skic2 APN 17 35,064,839 (GRCm39) missense probably damaging 1.00
IGL02729:Skic2 APN 17 35,058,581 (GRCm39) missense possibly damaging 0.63
IGL02839:Skic2 APN 17 35,066,774 (GRCm39) missense probably benign
R0325:Skic2 UTSW 17 35,063,791 (GRCm39) missense possibly damaging 0.50
R1102:Skic2 UTSW 17 35,059,082 (GRCm39) missense probably benign 0.28
R1294:Skic2 UTSW 17 35,060,040 (GRCm39) splice site probably null
R1557:Skic2 UTSW 17 35,067,398 (GRCm39) missense probably damaging 1.00
R1747:Skic2 UTSW 17 35,066,782 (GRCm39) missense probably benign 0.02
R2401:Skic2 UTSW 17 35,059,361 (GRCm39) missense probably benign
R3162:Skic2 UTSW 17 35,066,789 (GRCm39) nonsense probably null
R3162:Skic2 UTSW 17 35,066,789 (GRCm39) nonsense probably null
R3695:Skic2 UTSW 17 35,066,888 (GRCm39) missense probably damaging 1.00
R3700:Skic2 UTSW 17 35,068,879 (GRCm39) missense probably benign
R4654:Skic2 UTSW 17 35,068,922 (GRCm39) missense probably damaging 1.00
R4736:Skic2 UTSW 17 35,067,173 (GRCm39) missense possibly damaging 0.91
R4835:Skic2 UTSW 17 35,061,897 (GRCm39) missense possibly damaging 0.66
R5014:Skic2 UTSW 17 35,066,401 (GRCm39) missense probably benign 0.00
R5181:Skic2 UTSW 17 35,063,802 (GRCm39) missense probably benign 0.44
R5223:Skic2 UTSW 17 35,064,142 (GRCm39) critical splice donor site probably null
R5417:Skic2 UTSW 17 35,065,574 (GRCm39) missense probably damaging 0.98
R5623:Skic2 UTSW 17 35,066,408 (GRCm39) missense probably benign 0.00
R5878:Skic2 UTSW 17 35,065,093 (GRCm39) missense possibly damaging 0.83
R5979:Skic2 UTSW 17 35,060,439 (GRCm39) missense probably benign 0.01
R6412:Skic2 UTSW 17 35,059,276 (GRCm39) missense possibly damaging 0.92
R6501:Skic2 UTSW 17 35,063,412 (GRCm39) missense possibly damaging 0.95
R6532:Skic2 UTSW 17 35,063,719 (GRCm39) missense probably damaging 1.00
R6730:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6732:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6741:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6742:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6769:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6771:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R7022:Skic2 UTSW 17 35,064,183 (GRCm39) missense possibly damaging 0.88
R7096:Skic2 UTSW 17 35,060,446 (GRCm39) missense probably benign
R7178:Skic2 UTSW 17 35,058,440 (GRCm39) missense probably benign
R7315:Skic2 UTSW 17 35,060,145 (GRCm39) missense probably benign 0.00
R7584:Skic2 UTSW 17 35,060,651 (GRCm39) missense possibly damaging 0.69
R7677:Skic2 UTSW 17 35,067,140 (GRCm39) missense probably benign 0.03
R7796:Skic2 UTSW 17 35,063,394 (GRCm39) missense probably damaging 1.00
R8071:Skic2 UTSW 17 35,068,975 (GRCm39) missense probably benign 0.22
R8407:Skic2 UTSW 17 35,060,103 (GRCm39) missense probably benign 0.00
R8991:Skic2 UTSW 17 35,059,166 (GRCm39) missense probably damaging 1.00
R9016:Skic2 UTSW 17 35,063,640 (GRCm39) missense probably damaging 0.98
R9021:Skic2 UTSW 17 35,065,579 (GRCm39) missense probably damaging 1.00
R9196:Skic2 UTSW 17 35,068,877 (GRCm39) missense probably benign 0.00
R9243:Skic2 UTSW 17 35,064,198 (GRCm39) missense probably benign 0.33
R9322:Skic2 UTSW 17 35,066,439 (GRCm39) critical splice acceptor site probably null
R9475:Skic2 UTSW 17 35,060,078 (GRCm39) missense probably benign
R9564:Skic2 UTSW 17 35,063,758 (GRCm39) missense probably benign
R9565:Skic2 UTSW 17 35,063,758 (GRCm39) missense probably benign
Z1176:Skic2 UTSW 17 35,060,522 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGATCAAGAGGCTCCAGCAGAC -3'
(R):5'- ACTTTGAGAAAGGTGAAGTGGCCC -3'

Sequencing Primer
(F):5'- TCCAGCAGACGGCTGAG -3'
(R):5'- CGAAAAGGTGTCCTCTCTAGTAGC -3'
Posted On 2014-04-13