Mutagenetix > Incidental Mutation

Incidental Mutation 'R1514:Gm597'

168591

Institutional Source

Beutler Lab

Gene Symbol

Gm597

Ensembl Gene

ENSMUSG00000048411

Gene Name

predicted gene 597

Synonyms

LOC210962

MMRRC Submission

039561-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R1514 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28776117-28780252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28778748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 68 (T68S)

Ref Sequence

ENSEMBL: ENSMUSP00000058140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059937]

AlphaFold

E9Q8J5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059937
AA Change: T68S

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: T68S

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	112	129	N/A	INTRINSIC
Pfam:FAM75	137	472	8.1e-14	PFAM
low complexity region	664	675	N/A	INTRINSIC
internal_repeat_1	718	807	1.4e-5	PROSPERO
internal_repeat_1	807	894	1.4e-5	PROSPERO

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	A	10: 100,612,867	L147Q	probably damaging	Het
Abcb1a	A	G	5: 8,674,791	T75A	possibly damaging	Het
Acvr1	A	T	2: 58,447,585	L495*	probably null	Het
Add1	T	C	5: 34,610,617	I240T	probably benign	Het
Adgra2	C	A	8: 27,121,278	S870*	probably null	Het
Amer3	G	A	1: 34,579,327		probably benign	Het
Baz2b	A	T	2: 59,962,326	V486D	probably benign	Het
Bcorl1	T	A	X: 48,405,944	D1697E	probably damaging	Het
Cenpf	T	C	1: 189,679,141	D282G	possibly damaging	Het
Cep112	A	G	11: 108,472,054	D200G	probably damaging	Het
Clec4a4	C	T	6: 122,990,442	P26S	probably benign	Het
Crygf	A	C	1: 65,928,038	R102S	possibly damaging	Het
Cyp2b19	A	T	7: 26,767,160	E404D	probably benign	Het
Dcdc2a	A	G	13: 25,061,254	I105V	probably benign	Het
Dus4l	T	C	12: 31,640,939	M238V	probably damaging	Het
Eprs	G	A	1: 185,381,834	M326I	probably damaging	Het
Evpl	T	C	11: 116,223,835	T1010A	probably benign	Het
Fam124b	T	C	1: 80,200,431	T284A	possibly damaging	Het
Fam84a	C	T	12: 14,149,863	V288M	probably damaging	Het
Glb1l2	A	G	9: 26,769,124		probably benign	Het
Gm15922	G	A	7: 3,739,640	T23I	possibly damaging	Het
Gm16223	T	A	5: 42,067,955		probably null	Het
Gm438	T	C	4: 144,777,759	N274S	probably damaging	Het
Gm4952	T	A	19: 12,626,914	M230K	probably damaging	Het
Gm5828	C	A	1: 16,769,359		noncoding transcript	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifna16	T	A	4: 88,676,742	T39S	possibly damaging	Het
Kcnc3	G	A	7: 44,595,603	G439D	probably damaging	Het
Kif1c	T	C	11: 70,705,729	S257P	probably damaging	Het
Kng1	A	G	16: 23,079,760	K456E	probably damaging	Het
Lpxn	T	C	19: 12,824,050	L142P	probably damaging	Het
Med23	A	G	10: 24,892,667		probably benign	Het
Mgea5	A	G	19: 45,776,931	S146P	probably damaging	Het
Mks1	A	T	11: 87,861,111	D369V	probably benign	Het
Myo1d	A	T	11: 80,685,908	Y114N	probably damaging	Het
Npas2	A	G	1: 39,311,854	D126G	possibly damaging	Het
Olfr1314	T	C	2: 112,092,036	I222V	probably benign	Het
Olfr1420	A	G	19: 11,896,614	T198A	probably benign	Het
Olfr148	T	C	9: 39,613,696	I43T	probably damaging	Het
Onecut2	T	C	18: 64,341,580	F401L	possibly damaging	Het
Parp11	T	A	6: 127,474,293	F102Y	possibly damaging	Het
Pcnx	C	T	12: 81,918,798	H580Y	probably damaging	Het
Pde3b	A	G	7: 114,530,766	H852R	probably damaging	Het
Pou2af1	A	G	9: 51,233,208	T141A	probably benign	Het
Rgs22	A	C	15: 36,013,100	V1190G	probably benign	Het
Rnf112	T	C	11: 61,450,410	S450G	probably benign	Het
Rpgrip1l	A	T	8: 91,260,750	I893N	probably damaging	Het
Rps3a1	A	G	3: 86,138,527	V210A	probably benign	Het
Runx2	C	T	17: 44,735,337	A114T	possibly damaging	Het
Sardh	A	G	2: 27,197,690	V723A	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Secisbp2	A	G	13: 51,682,095	S742G	possibly damaging	Het
Selenow	G	T	7: 15,920,298		probably benign	Het
Slc30a4	A	G	2: 122,689,414	V226A	probably damaging	Het
Sntb2	A	G	8: 106,991,532	N291D	probably damaging	Het
Sorbs2	A	G	8: 45,769,829	T190A	probably damaging	Het
Specc1	T	A	11: 62,156,532	L909H	probably damaging	Het
Sprr1b	T	C	3: 92,437,107	*154W	probably null	Het
Taar4	T	A	10: 23,960,612	M40K	possibly damaging	Het
Ubr2	A	T	17: 47,000,823	L34H	probably damaging	Het
Ubxn6	T	C	17: 56,069,003	K386R	probably benign	Het
Vmn2r112	A	T	17: 22,602,844	T168S	probably benign	Het
Xirp2	A	T	2: 67,514,323	R2303*	probably null	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp13	G	T	17: 23,576,412	T395K	probably damaging	Het
Zfp281	A	G	1: 136,626,697	N471S	probably benign	Het

Other mutations in Gm597

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Gm597	APN	1	28778651	missense	possibly damaging	0.94
IGL00885:Gm597	APN	1	28776845	missense	unknown
IGL01296:Gm597	APN	1	28777056	missense	probably benign	0.23
IGL01476:Gm597	APN	1	28777453	missense	probably benign	0.04
IGL02125:Gm597	APN	1	28776338	missense	possibly damaging	0.91
IGL02410:Gm597	APN	1	28778631	missense	probably benign	0.25
IGL02982:Gm597	APN	1	28778054	missense	probably damaging	1.00
IGL03031:Gm597	APN	1	28778583	missense	probably benign	0.03
IGL03267:Gm597	APN	1	28777121	missense	probably damaging	1.00
R0294:Gm597	UTSW	1	28778663	missense	probably benign	0.00
R0433:Gm597	UTSW	1	28777342	nonsense	probably null
R0485:Gm597	UTSW	1	28778142	missense	probably damaging	1.00
R0645:Gm597	UTSW	1	28776930	missense	probably damaging	0.99
R0744:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R0836:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R1036:Gm597	UTSW	1	28777802	missense	probably benign	0.01
R1302:Gm597	UTSW	1	28776340	missense	probably benign	0.00
R1394:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1395:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1535:Gm597	UTSW	1	28777424	missense	probably damaging	1.00
R2004:Gm597	UTSW	1	28777179	missense	probably damaging	1.00
R2021:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R2022:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R3115:Gm597	UTSW	1	28776329	missense	possibly damaging	0.92
R3615:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3616:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3862:Gm597	UTSW	1	28777641	missense	probably damaging	0.98
R4067:Gm597	UTSW	1	28777631	missense	probably damaging	0.98
R4119:Gm597	UTSW	1	28777973	missense	probably damaging	0.99
R4415:Gm597	UTSW	1	28777133	missense	probably benign	0.01
R5010:Gm597	UTSW	1	28777862	missense	possibly damaging	0.52
R5109:Gm597	UTSW	1	28777555	missense	possibly damaging	0.46
R5122:Gm597	UTSW	1	28780060	missense	probably benign	0.00
R5533:Gm597	UTSW	1	28778082	missense	probably damaging	1.00
R6085:Gm597	UTSW	1	28778227	missense	possibly damaging	0.55
R6116:Gm597	UTSW	1	28778699	missense	probably benign	0.01
R6750:Gm597	UTSW	1	28777414	missense	probably damaging	0.98
R6757:Gm597	UTSW	1	28780110	missense	probably damaging	0.98
R6774:Gm597	UTSW	1	28776893	missense	probably benign	0.00
R7156:Gm597	UTSW	1	28776767	missense	possibly damaging	0.53
R7365:Gm597	UTSW	1	28780152	missense	probably benign	0.04
R7739:Gm597	UTSW	1	28777608	missense	possibly damaging	0.72
R7996:Gm597	UTSW	1	28778406	missense	probably damaging	0.98
R8082:Gm597	UTSW	1	28777498	missense	probably benign	0.08
R8281:Gm597	UTSW	1	28778144	missense	possibly damaging	0.77
R8514:Gm597	UTSW	1	28778505	missense	probably damaging	1.00
R8944:Gm597	UTSW	1	28777074	missense	probably benign	0.00
R9042:Gm597	UTSW	1	28776956	missense	possibly damaging	0.72
R9101:Gm597	UTSW	1	28776659	missense	probably benign	0.04
R9106:Gm597	UTSW	1	28776894	missense	probably benign	0.00
R9173:Gm597	UTSW	1	28777349	missense	probably benign	0.22
R9596:Gm597	UTSW	1	28776607	missense	probably benign	0.07
R9632:Gm597	UTSW	1	28778039	missense	probably benign	0.20
R9656:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9659:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9661:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9663:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9710:Gm597	UTSW	1	28778039	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TGCAGACAGTAGGCACAGTTGAATC -3'
(R):5'- AGCACATCTGTGGTAAGTGTGGC -3'

Sequencing Primer
(F):5'- GCACAGTTGAATCAGTGAACTC -3'
(R):5'- Tgagagagagagagagagagagag -3'

Posted On

2014-04-13