Incidental Mutation 'R1514:Npas2'
ID168593
Institutional Source Beutler Lab
Gene Symbol Npas2
Ensembl Gene ENSMUSG00000026077
Gene Nameneuronal PAS domain protein 2
SynonymsbHLHe9, MOP4
MMRRC Submission 039561-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1514 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location39193731-39363236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39311854 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 126 (D126G)
Ref Sequence ENSEMBL: ENSMUSP00000054719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056815
AA Change: D126G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: D126G

DomainStartEndE-ValueType
HLH 15 65 6.56e-10 SMART
PAS 84 150 4.28e-10 SMART
PAS 239 305 4.03e-6 SMART
PAC 311 354 6.2e-7 SMART
low complexity region 400 419 N/A INTRINSIC
coiled coil region 510 538 N/A INTRINSIC
low complexity region 563 583 N/A INTRINSIC
low complexity region 623 643 N/A INTRINSIC
low complexity region 745 768 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173076
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,867 L147Q probably damaging Het
Abcb1a A G 5: 8,674,791 T75A possibly damaging Het
Acvr1 A T 2: 58,447,585 L495* probably null Het
Add1 T C 5: 34,610,617 I240T probably benign Het
Adgra2 C A 8: 27,121,278 S870* probably null Het
Amer3 G A 1: 34,579,327 probably benign Het
Baz2b A T 2: 59,962,326 V486D probably benign Het
Bcorl1 T A X: 48,405,944 D1697E probably damaging Het
Cenpf T C 1: 189,679,141 D282G possibly damaging Het
Cep112 A G 11: 108,472,054 D200G probably damaging Het
Clec4a4 C T 6: 122,990,442 P26S probably benign Het
Crygf A C 1: 65,928,038 R102S possibly damaging Het
Cyp2b19 A T 7: 26,767,160 E404D probably benign Het
Dcdc2a A G 13: 25,061,254 I105V probably benign Het
Dus4l T C 12: 31,640,939 M238V probably damaging Het
Eprs G A 1: 185,381,834 M326I probably damaging Het
Evpl T C 11: 116,223,835 T1010A probably benign Het
Fam124b T C 1: 80,200,431 T284A possibly damaging Het
Fam84a C T 12: 14,149,863 V288M probably damaging Het
Glb1l2 A G 9: 26,769,124 probably benign Het
Gm15922 G A 7: 3,739,640 T23I possibly damaging Het
Gm16223 T A 5: 42,067,955 probably null Het
Gm438 T C 4: 144,777,759 N274S probably damaging Het
Gm4952 T A 19: 12,626,914 M230K probably damaging Het
Gm5828 C A 1: 16,769,359 noncoding transcript Het
Gm597 T A 1: 28,778,748 T68S possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna16 T A 4: 88,676,742 T39S possibly damaging Het
Kcnc3 G A 7: 44,595,603 G439D probably damaging Het
Kif1c T C 11: 70,705,729 S257P probably damaging Het
Kng1 A G 16: 23,079,760 K456E probably damaging Het
Lpxn T C 19: 12,824,050 L142P probably damaging Het
Med23 A G 10: 24,892,667 probably benign Het
Mgea5 A G 19: 45,776,931 S146P probably damaging Het
Mks1 A T 11: 87,861,111 D369V probably benign Het
Myo1d A T 11: 80,685,908 Y114N probably damaging Het
Olfr1314 T C 2: 112,092,036 I222V probably benign Het
Olfr1420 A G 19: 11,896,614 T198A probably benign Het
Olfr148 T C 9: 39,613,696 I43T probably damaging Het
Onecut2 T C 18: 64,341,580 F401L possibly damaging Het
Parp11 T A 6: 127,474,293 F102Y possibly damaging Het
Pcnx C T 12: 81,918,798 H580Y probably damaging Het
Pde3b A G 7: 114,530,766 H852R probably damaging Het
Pou2af1 A G 9: 51,233,208 T141A probably benign Het
Rgs22 A C 15: 36,013,100 V1190G probably benign Het
Rnf112 T C 11: 61,450,410 S450G probably benign Het
Rpgrip1l A T 8: 91,260,750 I893N probably damaging Het
Rps3a1 A G 3: 86,138,527 V210A probably benign Het
Runx2 C T 17: 44,735,337 A114T possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Secisbp2 A G 13: 51,682,095 S742G possibly damaging Het
Selenow G T 7: 15,920,298 probably benign Het
Slc30a4 A G 2: 122,689,414 V226A probably damaging Het
Sntb2 A G 8: 106,991,532 N291D probably damaging Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Specc1 T A 11: 62,156,532 L909H probably damaging Het
Sprr1b T C 3: 92,437,107 *154W probably null Het
Taar4 T A 10: 23,960,612 M40K possibly damaging Het
Ubr2 A T 17: 47,000,823 L34H probably damaging Het
Ubxn6 T C 17: 56,069,003 K386R probably benign Het
Vmn2r112 A T 17: 22,602,844 T168S probably benign Het
Xirp2 A T 2: 67,514,323 R2303* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp13 G T 17: 23,576,412 T395K probably damaging Het
Zfp281 A G 1: 136,626,697 N471S probably benign Het
Other mutations in Npas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Npas2 APN 1 39333961 splice site probably benign
IGL02608:Npas2 APN 1 39345446 missense probably benign 0.06
IGL02882:Npas2 APN 1 39312996 missense probably benign 0.08
IGL02976:Npas2 APN 1 39287484 missense probably damaging 1.00
IGL03130:Npas2 APN 1 39313028 missense probably damaging 1.00
IGL03297:Npas2 APN 1 39292690 missense possibly damaging 0.71
R1263:Npas2 UTSW 1 39334768 missense possibly damaging 0.51
R1618:Npas2 UTSW 1 39300727 missense probably damaging 1.00
R1620:Npas2 UTSW 1 39333912 missense possibly damaging 0.68
R1844:Npas2 UTSW 1 39325375 missense probably damaging 1.00
R1868:Npas2 UTSW 1 39300678 missense probably benign 0.03
R1892:Npas2 UTSW 1 39345422 missense probably benign 0.00
R2002:Npas2 UTSW 1 39338195 missense probably benign 0.10
R3157:Npas2 UTSW 1 39347609 missense possibly damaging 0.92
R3551:Npas2 UTSW 1 39287562 missense probably benign 0.05
R4564:Npas2 UTSW 1 39287566 missense probably damaging 1.00
R4907:Npas2 UTSW 1 39361985 missense unknown
R5044:Npas2 UTSW 1 39347506 nonsense probably null
R5621:Npas2 UTSW 1 39359713 missense probably benign
R5779:Npas2 UTSW 1 39287571 missense possibly damaging 0.48
R5822:Npas2 UTSW 1 39347566 missense probably benign 0.00
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6155:Npas2 UTSW 1 39287476 missense probably damaging 1.00
R6193:Npas2 UTSW 1 39292762 missense probably damaging 1.00
R6220:Npas2 UTSW 1 39336061 missense probably benign 0.00
R6341:Npas2 UTSW 1 39300687 missense probably damaging 0.98
R6656:Npas2 UTSW 1 39361948 missense unknown
R6778:Npas2 UTSW 1 39325300 missense possibly damaging 0.92
R6803:Npas2 UTSW 1 39336049 missense probably benign 0.35
R7165:Npas2 UTSW 1 39292717 missense possibly damaging 0.79
R7250:Npas2 UTSW 1 39338107 missense probably damaging 1.00
R7268:Npas2 UTSW 1 39287577 missense probably damaging 0.98
R7284:Npas2 UTSW 1 39324467 missense probably benign 0.36
R7833:Npas2 UTSW 1 39326147 missense probably damaging 1.00
R7994:Npas2 UTSW 1 39328337 missense possibly damaging 0.86
R8013:Npas2 UTSW 1 39338065 missense probably benign
R8054:Npas2 UTSW 1 39287571 missense possibly damaging 0.69
R8510:Npas2 UTSW 1 39287472 missense probably damaging 1.00
Z1176:Npas2 UTSW 1 39336010 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCATGAAGGGTCTTCTCAGACCTC -3'
(R):5'- ACGTGCTCCAAGTTCCAGTTTTAGC -3'

Sequencing Primer
(F):5'- GTCTTCTCAGACCTCGTGGC -3'
(R):5'- CTGAGTCACGAGGAAAATTATCC -3'
Posted On2014-04-13