Mutagenetix > Incidental Mutation

Incidental Mutation 'R1514:Sardh'

168599

Institutional Source

Beutler Lab

Gene Symbol

Sardh

Ensembl Gene

ENSMUSG00000009614

Gene Name

sarcosine dehydrogenase

Synonyms

MMRRC Submission

039561-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R1514 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27188393-27248337 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27197690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 723 (V723A)

Ref Sequence

ENSEMBL: ENSMUSP00000099950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102886]

AlphaFold

Q99LB7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000091224

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102886
AA Change: V723A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: V723A

Domain	Start	End	E-Value	Type
Pfam:DAO	69	428	1.7e-63	PFAM
Pfam:FAO_M	431	486	9.2e-22	PFAM
Pfam:GCV_T	489	799	3.1e-64	PFAM
Pfam:GCV_T_C	807	904	4.7e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127805

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170435

Meta Mutation Damage Score

0.4404

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	A	10: 100,612,867	L147Q	probably damaging	Het
Abcb1a	A	G	5: 8,674,791	T75A	possibly damaging	Het
Acvr1	A	T	2: 58,447,585	L495*	probably null	Het
Add1	T	C	5: 34,610,617	I240T	probably benign	Het
Adgra2	C	A	8: 27,121,278	S870*	probably null	Het
Amer3	G	A	1: 34,579,327		probably benign	Het
Baz2b	A	T	2: 59,962,326	V486D	probably benign	Het
Bcorl1	T	A	X: 48,405,944	D1697E	probably damaging	Het
Cenpf	T	C	1: 189,679,141	D282G	possibly damaging	Het
Cep112	A	G	11: 108,472,054	D200G	probably damaging	Het
Clec4a4	C	T	6: 122,990,442	P26S	probably benign	Het
Crygf	A	C	1: 65,928,038	R102S	possibly damaging	Het
Cyp2b19	A	T	7: 26,767,160	E404D	probably benign	Het
Dcdc2a	A	G	13: 25,061,254	I105V	probably benign	Het
Dus4l	T	C	12: 31,640,939	M238V	probably damaging	Het
Eprs	G	A	1: 185,381,834	M326I	probably damaging	Het
Evpl	T	C	11: 116,223,835	T1010A	probably benign	Het
Fam124b	T	C	1: 80,200,431	T284A	possibly damaging	Het
Fam84a	C	T	12: 14,149,863	V288M	probably damaging	Het
Glb1l2	A	G	9: 26,769,124		probably benign	Het
Gm15922	G	A	7: 3,739,640	T23I	possibly damaging	Het
Gm16223	T	A	5: 42,067,955		probably null	Het
Gm438	T	C	4: 144,777,759	N274S	probably damaging	Het
Gm4952	T	A	19: 12,626,914	M230K	probably damaging	Het
Gm5828	C	A	1: 16,769,359		noncoding transcript	Het
Gm597	T	A	1: 28,778,748	T68S	possibly damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifna16	T	A	4: 88,676,742	T39S	possibly damaging	Het
Kcnc3	G	A	7: 44,595,603	G439D	probably damaging	Het
Kif1c	T	C	11: 70,705,729	S257P	probably damaging	Het
Kng1	A	G	16: 23,079,760	K456E	probably damaging	Het
Lpxn	T	C	19: 12,824,050	L142P	probably damaging	Het
Med23	A	G	10: 24,892,667		probably benign	Het
Mgea5	A	G	19: 45,776,931	S146P	probably damaging	Het
Mks1	A	T	11: 87,861,111	D369V	probably benign	Het
Myo1d	A	T	11: 80,685,908	Y114N	probably damaging	Het
Npas2	A	G	1: 39,311,854	D126G	possibly damaging	Het
Olfr1314	T	C	2: 112,092,036	I222V	probably benign	Het
Olfr1420	A	G	19: 11,896,614	T198A	probably benign	Het
Olfr148	T	C	9: 39,613,696	I43T	probably damaging	Het
Onecut2	T	C	18: 64,341,580	F401L	possibly damaging	Het
Parp11	T	A	6: 127,474,293	F102Y	possibly damaging	Het
Pcnx	C	T	12: 81,918,798	H580Y	probably damaging	Het
Pde3b	A	G	7: 114,530,766	H852R	probably damaging	Het
Pou2af1	A	G	9: 51,233,208	T141A	probably benign	Het
Rgs22	A	C	15: 36,013,100	V1190G	probably benign	Het
Rnf112	T	C	11: 61,450,410	S450G	probably benign	Het
Rpgrip1l	A	T	8: 91,260,750	I893N	probably damaging	Het
Rps3a1	A	G	3: 86,138,527	V210A	probably benign	Het
Runx2	C	T	17: 44,735,337	A114T	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Secisbp2	A	G	13: 51,682,095	S742G	possibly damaging	Het
Selenow	G	T	7: 15,920,298		probably benign	Het
Slc30a4	A	G	2: 122,689,414	V226A	probably damaging	Het
Sntb2	A	G	8: 106,991,532	N291D	probably damaging	Het
Sorbs2	A	G	8: 45,769,829	T190A	probably damaging	Het
Specc1	T	A	11: 62,156,532	L909H	probably damaging	Het
Sprr1b	T	C	3: 92,437,107	*154W	probably null	Het
Taar4	T	A	10: 23,960,612	M40K	possibly damaging	Het
Ubr2	A	T	17: 47,000,823	L34H	probably damaging	Het
Ubxn6	T	C	17: 56,069,003	K386R	probably benign	Het
Vmn2r112	A	T	17: 22,602,844	T168S	probably benign	Het
Xirp2	A	T	2: 67,514,323	R2303*	probably null	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp13	G	T	17: 23,576,412	T395K	probably damaging	Het
Zfp281	A	G	1: 136,626,697	N471S	probably benign	Het

Other mutations in Sardh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01110:Sardh	APN	2	27215113	missense	probably benign	0.07
IGL01686:Sardh	APN	2	27189613	missense	probably damaging	1.00
IGL01868:Sardh	APN	2	27227147	missense	probably benign	0.35
IGL02167:Sardh	APN	2	27191975	missense	probably damaging	0.98
IGL02272:Sardh	APN	2	27224991	missense	probably benign	0.00
IGL02870:Sardh	APN	2	27235491	missense	possibly damaging	0.93
IGL03117:Sardh	APN	2	27239446	missense	probably damaging	1.00
PIT4305001:Sardh	UTSW	2	27228314	missense	probably damaging	1.00
PIT4791001:Sardh	UTSW	2	27197648	missense	probably damaging	1.00
R0265:Sardh	UTSW	2	27227066	splice site	probably benign
R0781:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1110:Sardh	UTSW	2	27191919	missense	possibly damaging	0.82
R1242:Sardh	UTSW	2	27235563	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1404:Sardh	UTSW	2	27239461	missense	probably damaging	1.00
R1565:Sardh	UTSW	2	27242719	missense	probably damaging	1.00
R1832:Sardh	UTSW	2	27235569	missense	possibly damaging	0.95
R1836:Sardh	UTSW	2	27215182	missense	possibly damaging	0.65
R1997:Sardh	UTSW	2	27244397	missense	probably damaging	0.97
R2006:Sardh	UTSW	2	27228339	missense	probably damaging	1.00
R2046:Sardh	UTSW	2	27215082	missense	possibly damaging	0.95
R2242:Sardh	UTSW	2	27235515	missense	possibly damaging	0.93
R2897:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R4332:Sardh	UTSW	2	27215114	missense	possibly damaging	0.85
R4807:Sardh	UTSW	2	27189527	missense	probably benign	0.00
R4841:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4842:Sardh	UTSW	2	27191955	missense	probably benign	0.09
R4856:Sardh	UTSW	2	27244477	missense	probably benign	0.02
R4936:Sardh	UTSW	2	27228241	splice site	probably null
R5089:Sardh	UTSW	2	27239613	critical splice donor site	probably null
R5110:Sardh	UTSW	2	27189547	missense	probably benign	0.00
R5257:Sardh	UTSW	2	27244259	missense	probably damaging	0.98
R5406:Sardh	UTSW	2	27211084	missense	possibly damaging	0.72
R5450:Sardh	UTSW	2	27239698	missense	possibly damaging	0.65
R5594:Sardh	UTSW	2	27220723	missense	probably damaging	1.00
R5870:Sardh	UTSW	2	27220641	critical splice donor site	probably null
R6014:Sardh	UTSW	2	27197528	critical splice donor site	probably null
R6021:Sardh	UTSW	2	27189643	missense	probably benign	0.44
R6470:Sardh	UTSW	2	27244372	missense	probably damaging	1.00
R6577:Sardh	UTSW	2	27218855	missense	possibly damaging	0.95
R6750:Sardh	UTSW	2	27228257	missense	probably benign	0.04
R7035:Sardh	UTSW	2	27230842	missense	probably damaging	1.00
R7162:Sardh	UTSW	2	27197690	missense	possibly damaging	0.95
R7256:Sardh	UTSW	2	27218812	missense	probably benign
R7692:Sardh	UTSW	2	27197639	missense	probably benign	0.01
R7709:Sardh	UTSW	2	27241517	missense	possibly damaging	0.62
R7884:Sardh	UTSW	2	27239371	missense	probably damaging	0.99
R8028:Sardh	UTSW	2	27230455	missense	probably damaging	1.00
R8095:Sardh	UTSW	2	27242718	missense	probably damaging	1.00
R8120:Sardh	UTSW	2	27218851	missense	possibly damaging	0.62
R8302:Sardh	UTSW	2	27215110	missense	probably benign	0.03
R8323:Sardh	UTSW	2	27235564	missense	probably damaging	1.00
R8535:Sardh	UTSW	2	27239645	missense	probably damaging	1.00
R8704:Sardh	UTSW	2	27230465	missense	possibly damaging	0.50
R8781:Sardh	UTSW	2	27196703	missense	possibly damaging	0.95
R8858:Sardh	UTSW	2	27228290	missense	probably null	1.00
R9265:Sardh	UTSW	2	27215053	missense	probably damaging	0.99
R9337:Sardh	UTSW	2	27196666	missense	probably benign	0.11
R9342:Sardh	UTSW	2	27230857	missense	possibly damaging	0.95
R9539:Sardh	UTSW	2	27244286	missense	probably damaging	0.99
R9600:Sardh	UTSW	2	27230501	missense	probably benign
R9714:Sardh	UTSW	2	27189629	missense	possibly damaging	0.64
X0011:Sardh	UTSW	2	27242746	missense	probably damaging	1.00
Z1176:Sardh	UTSW	2	27196673	missense	probably benign	0.08
Z1176:Sardh	UTSW	2	27218834	missense	possibly damaging	0.88
Z1176:Sardh	UTSW	2	27218890	missense	possibly damaging	0.52
Z1177:Sardh	UTSW	2	27235513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCGATGCTCAGGGAGTCGATG -3'
(R):5'- AGCTTGACCACAGGGAACCTGC -3'

Sequencing Primer
(F):5'- AGTCGATGGCACGGTAGC -3'
(R):5'- ATTTCTCAGTGACTGCTGGC -3'

Posted On

2014-04-13