Incidental Mutation 'R1514:Parp11'
ID 168615
Institutional Source Beutler Lab
Gene Symbol Parp11
Ensembl Gene ENSMUSG00000037997
Gene Name poly (ADP-ribose) polymerase family, member 11
Synonyms 5330431N24Rik, HIN1L
MMRRC Submission 039561-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1514 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 127423803-127471224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127451256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 102 (F102Y)
Ref Sequence ENSEMBL: ENSMUSP00000107814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039680] [ENSMUST00000112191] [ENSMUST00000112193] [ENSMUST00000112195] [ENSMUST00000144115]
AlphaFold Q8CFF0
Predicted Effect possibly damaging
Transcript: ENSMUST00000039680
AA Change: F102Y

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036127
Gene: ENSMUSG00000037997
AA Change: F102Y

DomainStartEndE-ValueType
Pfam:WWE 25 99 1.4e-18 PFAM
Pfam:PARP 129 331 4.1e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112191
AA Change: F19Y

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107810
Gene: ENSMUSG00000037997
AA Change: F19Y

DomainStartEndE-ValueType
Pfam:PARP 46 248 4e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112193
AA Change: F102Y

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107812
Gene: ENSMUSG00000037997
AA Change: F102Y

DomainStartEndE-ValueType
Pfam:WWE 22 99 4.5e-12 PFAM
Pfam:PARP 129 176 2.3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112195
AA Change: F102Y

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107814
Gene: ENSMUSG00000037997
AA Change: F102Y

DomainStartEndE-ValueType
Pfam:WWE 22 99 4.5e-12 PFAM
Pfam:PARP 129 176 2.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134018
Predicted Effect probably benign
Transcript: ENSMUST00000144115
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired male fertility and teratozoospermia associated with sperm head malformations and nuclear envelope defects during the nuclear reshaping process of spermatid elongation and condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,448,729 (GRCm39) L147Q probably damaging Het
Aadacl4fm5 T C 4: 144,504,329 (GRCm39) N274S probably damaging Het
Abcb1a A G 5: 8,724,791 (GRCm39) T75A possibly damaging Het
Acvr1 A T 2: 58,337,597 (GRCm39) L495* probably null Het
Add1 T C 5: 34,767,961 (GRCm39) I240T probably benign Het
Adgra2 C A 8: 27,611,306 (GRCm39) S870* probably null Het
Amer3 G A 1: 34,618,408 (GRCm39) probably benign Het
Baz2b A T 2: 59,792,670 (GRCm39) V486D probably benign Het
Bcorl1 T A X: 47,494,821 (GRCm39) D1697E probably damaging Het
Cenpf T C 1: 189,411,338 (GRCm39) D282G possibly damaging Het
Cep112 A G 11: 108,362,880 (GRCm39) D200G probably damaging Het
Clec4a4 C T 6: 122,967,401 (GRCm39) P26S probably benign Het
Crygf A C 1: 65,967,197 (GRCm39) R102S possibly damaging Het
Cyp2b19 A T 7: 26,466,585 (GRCm39) E404D probably benign Het
Dcdc2a A G 13: 25,245,237 (GRCm39) I105V probably benign Het
Dus4l T C 12: 31,690,938 (GRCm39) M238V probably damaging Het
Eprs1 G A 1: 185,114,031 (GRCm39) M326I probably damaging Het
Evpl T C 11: 116,114,661 (GRCm39) T1010A probably benign Het
Fam124b T C 1: 80,178,148 (GRCm39) T284A possibly damaging Het
Glb1l2 A G 9: 26,680,420 (GRCm39) probably benign Het
Gm16223 T A 5: 42,225,298 (GRCm39) probably null Het
Gm4952 T A 19: 12,604,278 (GRCm39) M230K probably damaging Het
Gm5828 C A 1: 16,839,583 (GRCm39) noncoding transcript Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ifna16 T A 4: 88,594,979 (GRCm39) T39S possibly damaging Het
Kcnc3 G A 7: 44,245,027 (GRCm39) G439D probably damaging Het
Kif1c T C 11: 70,596,555 (GRCm39) S257P probably damaging Het
Kng1 A G 16: 22,898,510 (GRCm39) K456E probably damaging Het
Lpxn T C 19: 12,801,414 (GRCm39) L142P probably damaging Het
Lratd1 C T 12: 14,199,864 (GRCm39) V288M probably damaging Het
Med23 A G 10: 24,768,565 (GRCm39) probably benign Het
Mks1 A T 11: 87,751,937 (GRCm39) D369V probably benign Het
Myo1d A T 11: 80,576,734 (GRCm39) Y114N probably damaging Het
Npas2 A G 1: 39,350,935 (GRCm39) D126G possibly damaging Het
Oga A G 19: 45,765,370 (GRCm39) S146P probably damaging Het
Onecut2 T C 18: 64,474,651 (GRCm39) F401L possibly damaging Het
Or10n1 T C 9: 39,524,992 (GRCm39) I43T probably damaging Het
Or10v1 A G 19: 11,873,978 (GRCm39) T198A probably benign Het
Or4f61 T C 2: 111,922,381 (GRCm39) I222V probably benign Het
Pcnx1 C T 12: 81,965,572 (GRCm39) H580Y probably damaging Het
Pde3b A G 7: 114,130,001 (GRCm39) H852R probably damaging Het
Pira1 G A 7: 3,742,639 (GRCm39) T23I possibly damaging Het
Pou2af1 A G 9: 51,144,508 (GRCm39) T141A probably benign Het
Rgs22 A C 15: 36,013,246 (GRCm39) V1190G probably benign Het
Rnf112 T C 11: 61,341,236 (GRCm39) S450G probably benign Het
Rpgrip1l A T 8: 91,987,378 (GRCm39) I893N probably damaging Het
Rps3a1 A G 3: 86,045,834 (GRCm39) V210A probably benign Het
Runx2 C T 17: 45,046,224 (GRCm39) A114T possibly damaging Het
Sardh A G 2: 27,087,702 (GRCm39) V723A possibly damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Secisbp2 A G 13: 51,836,131 (GRCm39) S742G possibly damaging Het
Selenow G T 7: 15,654,223 (GRCm39) probably benign Het
Slc30a4 A G 2: 122,531,334 (GRCm39) V226A probably damaging Het
Sntb2 A G 8: 107,718,164 (GRCm39) N291D probably damaging Het
Sorbs2 A G 8: 46,222,866 (GRCm39) T190A probably damaging Het
Spata31e5 T A 1: 28,817,829 (GRCm39) T68S possibly damaging Het
Specc1 T A 11: 62,047,358 (GRCm39) L909H probably damaging Het
Sprr1b T C 3: 92,344,414 (GRCm39) *154W probably null Het
Taar4 T A 10: 23,836,510 (GRCm39) M40K possibly damaging Het
Ubr2 A T 17: 47,311,749 (GRCm39) L34H probably damaging Het
Ubxn6 T C 17: 56,376,003 (GRCm39) K386R probably benign Het
Vmn2r112 A T 17: 22,821,825 (GRCm39) T168S probably benign Het
Xirp2 A T 2: 67,344,667 (GRCm39) R2303* probably null Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp13 G T 17: 23,795,386 (GRCm39) T395K probably damaging Het
Zfp281 A G 1: 136,554,435 (GRCm39) N471S probably benign Het
Other mutations in Parp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Parp11 APN 6 127,448,526 (GRCm39) nonsense probably null
IGL01548:Parp11 APN 6 127,468,562 (GRCm39) missense probably damaging 1.00
IGL01638:Parp11 APN 6 127,468,492 (GRCm39) missense probably benign 0.13
IGL01688:Parp11 APN 6 127,448,569 (GRCm39) missense probably benign 0.00
IGL03201:Parp11 APN 6 127,466,981 (GRCm39) missense possibly damaging 0.80
IGL03297:Parp11 APN 6 127,467,045 (GRCm39) splice site probably benign
H8786:Parp11 UTSW 6 127,448,598 (GRCm39) missense probably damaging 1.00
R1817:Parp11 UTSW 6 127,467,008 (GRCm39) missense probably damaging 1.00
R1868:Parp11 UTSW 6 127,447,740 (GRCm39) missense probably damaging 1.00
R1942:Parp11 UTSW 6 127,447,663 (GRCm39) critical splice acceptor site probably null
R2011:Parp11 UTSW 6 127,454,854 (GRCm39) missense probably benign 0.02
R4483:Parp11 UTSW 6 127,448,568 (GRCm39) missense probably benign
R4507:Parp11 UTSW 6 127,451,246 (GRCm39) missense probably damaging 1.00
R4593:Parp11 UTSW 6 127,451,262 (GRCm39) missense probably benign 0.03
R5024:Parp11 UTSW 6 127,448,599 (GRCm39) missense probably damaging 1.00
R5371:Parp11 UTSW 6 127,447,755 (GRCm39) missense probably damaging 1.00
R6608:Parp11 UTSW 6 127,454,811 (GRCm39) missense possibly damaging 0.93
R7606:Parp11 UTSW 6 127,447,723 (GRCm39) missense probably benign 0.06
R8772:Parp11 UTSW 6 127,468,667 (GRCm39) missense probably damaging 1.00
R8772:Parp11 UTSW 6 127,447,726 (GRCm39) missense possibly damaging 0.77
R9042:Parp11 UTSW 6 127,448,615 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTCTCTCCAAAGCTGTGTAACC -3'
(R):5'- TAGTGCAGGGGCACACCAAATG -3'

Sequencing Primer
(F):5'- GTAACCTTCATGTATTGTGGCAC -3'
(R):5'- ACCAAATGGGCAGTTCTCTAAG -3'
Posted On 2014-04-13