Incidental Mutation 'R1514:Hsh2d'
ID168622
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
MMRRC Submission 039561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1514 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72200460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 229 (D229N)
Ref Sequence ENSEMBL: ENSMUSP00000127575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000098630] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098630
SMART Domains Protein: ENSMUSP00000096231
Gene: ENSMUSG00000074240

DomainStartEndE-ValueType
EFh 43 71 3.97e1 SMART
EFh 80 108 4.32e1 SMART
EFh 121 149 1.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165324
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211946
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,867 L147Q probably damaging Het
Abcb1a A G 5: 8,674,791 T75A possibly damaging Het
Acvr1 A T 2: 58,447,585 L495* probably null Het
Add1 T C 5: 34,610,617 I240T probably benign Het
Adgra2 C A 8: 27,121,278 S870* probably null Het
Amer3 G A 1: 34,579,327 probably benign Het
Baz2b A T 2: 59,962,326 V486D probably benign Het
Bcorl1 T A X: 48,405,944 D1697E probably damaging Het
Cenpf T C 1: 189,679,141 D282G possibly damaging Het
Cep112 A G 11: 108,472,054 D200G probably damaging Het
Clec4a4 C T 6: 122,990,442 P26S probably benign Het
Crygf A C 1: 65,928,038 R102S possibly damaging Het
Cyp2b19 A T 7: 26,767,160 E404D probably benign Het
Dcdc2a A G 13: 25,061,254 I105V probably benign Het
Dus4l T C 12: 31,640,939 M238V probably damaging Het
Eprs G A 1: 185,381,834 M326I probably damaging Het
Evpl T C 11: 116,223,835 T1010A probably benign Het
Fam124b T C 1: 80,200,431 T284A possibly damaging Het
Fam84a C T 12: 14,149,863 V288M probably damaging Het
Glb1l2 A G 9: 26,769,124 probably benign Het
Gm15922 G A 7: 3,739,640 T23I possibly damaging Het
Gm16223 T A 5: 42,067,955 probably null Het
Gm438 T C 4: 144,777,759 N274S probably damaging Het
Gm4952 T A 19: 12,626,914 M230K probably damaging Het
Gm5828 C A 1: 16,769,359 noncoding transcript Het
Gm597 T A 1: 28,778,748 T68S possibly damaging Het
Ifna16 T A 4: 88,676,742 T39S possibly damaging Het
Kcnc3 G A 7: 44,595,603 G439D probably damaging Het
Kif1c T C 11: 70,705,729 S257P probably damaging Het
Kng1 A G 16: 23,079,760 K456E probably damaging Het
Lpxn T C 19: 12,824,050 L142P probably damaging Het
Med23 A G 10: 24,892,667 probably benign Het
Mgea5 A G 19: 45,776,931 S146P probably damaging Het
Mks1 A T 11: 87,861,111 D369V probably benign Het
Myo1d A T 11: 80,685,908 Y114N probably damaging Het
Npas2 A G 1: 39,311,854 D126G possibly damaging Het
Olfr1314 T C 2: 112,092,036 I222V probably benign Het
Olfr1420 A G 19: 11,896,614 T198A probably benign Het
Olfr148 T C 9: 39,613,696 I43T probably damaging Het
Onecut2 T C 18: 64,341,580 F401L possibly damaging Het
Parp11 T A 6: 127,474,293 F102Y possibly damaging Het
Pcnx C T 12: 81,918,798 H580Y probably damaging Het
Pde3b A G 7: 114,530,766 H852R probably damaging Het
Pou2af1 A G 9: 51,233,208 T141A probably benign Het
Rgs22 A C 15: 36,013,100 V1190G probably benign Het
Rnf112 T C 11: 61,450,410 S450G probably benign Het
Rpgrip1l A T 8: 91,260,750 I893N probably damaging Het
Rps3a1 A G 3: 86,138,527 V210A probably benign Het
Runx2 C T 17: 44,735,337 A114T possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Secisbp2 A G 13: 51,682,095 S742G possibly damaging Het
Selenow G T 7: 15,920,298 probably benign Het
Slc30a4 A G 2: 122,689,414 V226A probably damaging Het
Sntb2 A G 8: 106,991,532 N291D probably damaging Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Specc1 T A 11: 62,156,532 L909H probably damaging Het
Sprr1b T C 3: 92,437,107 *154W probably null Het
Taar4 T A 10: 23,960,612 M40K possibly damaging Het
Ubr2 A T 17: 47,000,823 L34H probably damaging Het
Ubxn6 T C 17: 56,069,003 K386R probably benign Het
Vmn2r112 A T 17: 22,602,844 T168S probably benign Het
Xirp2 A T 2: 67,514,323 R2303* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp13 G T 17: 23,576,412 T395K probably damaging Het
Zfp281 A G 1: 136,626,697 N471S probably benign Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0948:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1371:Hsh2d UTSW 8 72196894 splice site probably benign
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2050:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2081:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R6550:Hsh2d UTSW 8 72198453 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
R7673:Hsh2d UTSW 8 72200511 missense probably benign 0.15
R7911:Hsh2d UTSW 8 72196804 missense probably damaging 1.00
R7992:Hsh2d UTSW 8 72196804 missense probably damaging 1.00
Y4335:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACACTTGCAGTCCAACTGTGTC -3'
(R):5'- GCTTTGACCCCTGAGAATGCCTTC -3'

Sequencing Primer
(F):5'- GCTTCTGAAAGGAAGCCATC -3'
(R):5'- GAGAATGCCTTCCTCCAGC -3'
Posted On2014-04-13