Incidental Mutation 'R1514:Med23'
ID 168629
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms ESTM7, 3000002A17Rik, X83317, Sur2, Crsp3, sno
MMRRC Submission 039561-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1514 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 24745889-24789358 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 24768565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020159
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably benign
Transcript: ENSMUST00000176285
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176502
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179967
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,448,729 (GRCm39) L147Q probably damaging Het
Aadacl4fm5 T C 4: 144,504,329 (GRCm39) N274S probably damaging Het
Abcb1a A G 5: 8,724,791 (GRCm39) T75A possibly damaging Het
Acvr1 A T 2: 58,337,597 (GRCm39) L495* probably null Het
Add1 T C 5: 34,767,961 (GRCm39) I240T probably benign Het
Adgra2 C A 8: 27,611,306 (GRCm39) S870* probably null Het
Amer3 G A 1: 34,618,408 (GRCm39) probably benign Het
Baz2b A T 2: 59,792,670 (GRCm39) V486D probably benign Het
Bcorl1 T A X: 47,494,821 (GRCm39) D1697E probably damaging Het
Cenpf T C 1: 189,411,338 (GRCm39) D282G possibly damaging Het
Cep112 A G 11: 108,362,880 (GRCm39) D200G probably damaging Het
Clec4a4 C T 6: 122,967,401 (GRCm39) P26S probably benign Het
Crygf A C 1: 65,967,197 (GRCm39) R102S possibly damaging Het
Cyp2b19 A T 7: 26,466,585 (GRCm39) E404D probably benign Het
Dcdc2a A G 13: 25,245,237 (GRCm39) I105V probably benign Het
Dus4l T C 12: 31,690,938 (GRCm39) M238V probably damaging Het
Eprs1 G A 1: 185,114,031 (GRCm39) M326I probably damaging Het
Evpl T C 11: 116,114,661 (GRCm39) T1010A probably benign Het
Fam124b T C 1: 80,178,148 (GRCm39) T284A possibly damaging Het
Glb1l2 A G 9: 26,680,420 (GRCm39) probably benign Het
Gm16223 T A 5: 42,225,298 (GRCm39) probably null Het
Gm4952 T A 19: 12,604,278 (GRCm39) M230K probably damaging Het
Gm5828 C A 1: 16,839,583 (GRCm39) noncoding transcript Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ifna16 T A 4: 88,594,979 (GRCm39) T39S possibly damaging Het
Kcnc3 G A 7: 44,245,027 (GRCm39) G439D probably damaging Het
Kif1c T C 11: 70,596,555 (GRCm39) S257P probably damaging Het
Kng1 A G 16: 22,898,510 (GRCm39) K456E probably damaging Het
Lpxn T C 19: 12,801,414 (GRCm39) L142P probably damaging Het
Lratd1 C T 12: 14,199,864 (GRCm39) V288M probably damaging Het
Mks1 A T 11: 87,751,937 (GRCm39) D369V probably benign Het
Myo1d A T 11: 80,576,734 (GRCm39) Y114N probably damaging Het
Npas2 A G 1: 39,350,935 (GRCm39) D126G possibly damaging Het
Oga A G 19: 45,765,370 (GRCm39) S146P probably damaging Het
Onecut2 T C 18: 64,474,651 (GRCm39) F401L possibly damaging Het
Or10n1 T C 9: 39,524,992 (GRCm39) I43T probably damaging Het
Or10v1 A G 19: 11,873,978 (GRCm39) T198A probably benign Het
Or4f61 T C 2: 111,922,381 (GRCm39) I222V probably benign Het
Parp11 T A 6: 127,451,256 (GRCm39) F102Y possibly damaging Het
Pcnx1 C T 12: 81,965,572 (GRCm39) H580Y probably damaging Het
Pde3b A G 7: 114,130,001 (GRCm39) H852R probably damaging Het
Pira1 G A 7: 3,742,639 (GRCm39) T23I possibly damaging Het
Pou2af1 A G 9: 51,144,508 (GRCm39) T141A probably benign Het
Rgs22 A C 15: 36,013,246 (GRCm39) V1190G probably benign Het
Rnf112 T C 11: 61,341,236 (GRCm39) S450G probably benign Het
Rpgrip1l A T 8: 91,987,378 (GRCm39) I893N probably damaging Het
Rps3a1 A G 3: 86,045,834 (GRCm39) V210A probably benign Het
Runx2 C T 17: 45,046,224 (GRCm39) A114T possibly damaging Het
Sardh A G 2: 27,087,702 (GRCm39) V723A possibly damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Secisbp2 A G 13: 51,836,131 (GRCm39) S742G possibly damaging Het
Selenow G T 7: 15,654,223 (GRCm39) probably benign Het
Slc30a4 A G 2: 122,531,334 (GRCm39) V226A probably damaging Het
Sntb2 A G 8: 107,718,164 (GRCm39) N291D probably damaging Het
Sorbs2 A G 8: 46,222,866 (GRCm39) T190A probably damaging Het
Spata31e5 T A 1: 28,817,829 (GRCm39) T68S possibly damaging Het
Specc1 T A 11: 62,047,358 (GRCm39) L909H probably damaging Het
Sprr1b T C 3: 92,344,414 (GRCm39) *154W probably null Het
Taar4 T A 10: 23,836,510 (GRCm39) M40K possibly damaging Het
Ubr2 A T 17: 47,311,749 (GRCm39) L34H probably damaging Het
Ubxn6 T C 17: 56,376,003 (GRCm39) K386R probably benign Het
Vmn2r112 A T 17: 22,821,825 (GRCm39) T168S probably benign Het
Xirp2 A T 2: 67,344,667 (GRCm39) R2303* probably null Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp13 G T 17: 23,795,386 (GRCm39) T395K probably damaging Het
Zfp281 A G 1: 136,554,435 (GRCm39) N471S probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24,764,482 (GRCm39) missense probably damaging 1.00
IGL00792:Med23 APN 10 24,752,902 (GRCm39) missense possibly damaging 0.93
IGL01289:Med23 APN 10 24,778,019 (GRCm39) missense probably damaging 1.00
IGL01469:Med23 APN 10 24,758,495 (GRCm39) missense probably damaging 1.00
IGL01598:Med23 APN 10 24,779,696 (GRCm39) missense probably benign 0.34
IGL02324:Med23 APN 10 24,773,239 (GRCm39) missense probably damaging 0.98
IGL02381:Med23 APN 10 24,776,626 (GRCm39) missense possibly damaging 0.95
IGL02465:Med23 APN 10 24,779,641 (GRCm39) missense probably damaging 0.96
IGL02554:Med23 APN 10 24,774,473 (GRCm39) critical splice donor site probably null
IGL02683:Med23 APN 10 24,746,615 (GRCm39) missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R0080:Med23 UTSW 10 24,788,715 (GRCm39) missense probably benign 0.33
R0125:Med23 UTSW 10 24,776,686 (GRCm39) missense probably damaging 1.00
R0311:Med23 UTSW 10 24,773,256 (GRCm39) missense possibly damaging 0.95
R0765:Med23 UTSW 10 24,776,608 (GRCm39) missense probably damaging 1.00
R1302:Med23 UTSW 10 24,764,320 (GRCm39) splice site probably null
R1456:Med23 UTSW 10 24,779,550 (GRCm39) splice site probably benign
R1774:Med23 UTSW 10 24,779,584 (GRCm39) missense probably damaging 1.00
R1851:Med23 UTSW 10 24,786,768 (GRCm39) splice site probably null
R1928:Med23 UTSW 10 24,785,710 (GRCm39) missense probably benign
R1975:Med23 UTSW 10 24,786,664 (GRCm39) missense probably benign 0.01
R2011:Med23 UTSW 10 24,755,653 (GRCm39) missense possibly damaging 0.63
R2266:Med23 UTSW 10 24,750,499 (GRCm39) missense probably benign 0.00
R2309:Med23 UTSW 10 24,746,586 (GRCm39) missense probably damaging 0.99
R2507:Med23 UTSW 10 24,786,711 (GRCm39) missense probably damaging 1.00
R2566:Med23 UTSW 10 24,764,473 (GRCm39) missense probably damaging 1.00
R3720:Med23 UTSW 10 24,767,018 (GRCm39) missense probably damaging 1.00
R3771:Med23 UTSW 10 24,778,099 (GRCm39) missense probably damaging 1.00
R3811:Med23 UTSW 10 24,768,491 (GRCm39) splice site probably null
R3811:Med23 UTSW 10 24,768,490 (GRCm39) nonsense probably null
R4305:Med23 UTSW 10 24,780,168 (GRCm39) nonsense probably null
R4323:Med23 UTSW 10 24,746,603 (GRCm39) missense probably benign 0.02
R4701:Med23 UTSW 10 24,769,546 (GRCm39) missense probably damaging 1.00
R4886:Med23 UTSW 10 24,750,581 (GRCm39) critical splice donor site probably null
R4925:Med23 UTSW 10 24,786,645 (GRCm39) missense probably damaging 1.00
R4943:Med23 UTSW 10 24,751,567 (GRCm39) missense possibly damaging 0.92
R5207:Med23 UTSW 10 24,771,734 (GRCm39) nonsense probably null
R5749:Med23 UTSW 10 24,764,347 (GRCm39) missense possibly damaging 0.84
R5806:Med23 UTSW 10 24,783,119 (GRCm39) missense probably damaging 1.00
R5896:Med23 UTSW 10 24,778,043 (GRCm39) missense probably damaging 1.00
R5954:Med23 UTSW 10 24,746,381 (GRCm39) splice site probably benign
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6093:Med23 UTSW 10 24,754,341 (GRCm39) missense probably benign 0.16
R6107:Med23 UTSW 10 24,781,932 (GRCm39) nonsense probably null
R6356:Med23 UTSW 10 24,764,311 (GRCm39) missense probably damaging 0.98
R6393:Med23 UTSW 10 24,749,374 (GRCm39) missense possibly damaging 0.91
R6533:Med23 UTSW 10 24,769,518 (GRCm39) missense probably damaging 1.00
R6911:Med23 UTSW 10 24,778,079 (GRCm39) missense probably damaging 0.98
R6981:Med23 UTSW 10 24,771,722 (GRCm39) missense possibly damaging 0.92
R7085:Med23 UTSW 10 24,746,019 (GRCm39) missense probably damaging 1.00
R7215:Med23 UTSW 10 24,764,327 (GRCm39) missense probably benign
R7229:Med23 UTSW 10 24,777,902 (GRCm39) missense probably benign
R7489:Med23 UTSW 10 24,780,254 (GRCm39) missense probably damaging 1.00
R7530:Med23 UTSW 10 24,781,851 (GRCm39) missense probably benign 0.00
R7643:Med23 UTSW 10 24,781,863 (GRCm39) missense probably benign 0.01
R7653:Med23 UTSW 10 24,780,282 (GRCm39) missense probably damaging 1.00
R7764:Med23 UTSW 10 24,785,818 (GRCm39) critical splice donor site probably null
R7784:Med23 UTSW 10 24,778,346 (GRCm39) missense probably damaging 1.00
R8024:Med23 UTSW 10 24,755,581 (GRCm39) missense possibly damaging 0.74
R8182:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R8412:Med23 UTSW 10 24,784,632 (GRCm39) missense probably benign 0.01
R8874:Med23 UTSW 10 24,771,617 (GRCm39) missense possibly damaging 0.92
R8975:Med23 UTSW 10 24,780,334 (GRCm39) missense probably benign 0.42
R9131:Med23 UTSW 10 24,780,279 (GRCm39) missense
R9202:Med23 UTSW 10 24,780,202 (GRCm39) missense probably benign 0.12
R9341:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9342:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R9343:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9412:Med23 UTSW 10 24,778,019 (GRCm39) missense probably damaging 1.00
RF003:Med23 UTSW 10 24,779,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCGCTACACCGTAAAGGATTTCTG -3'
(R):5'- GATACCCAAGCACATGAGAAGGCTC -3'

Sequencing Primer
(F):5'- CACCGTAAAGGATTTCTGAGCTG -3'
(R):5'- TGAGAAGGCTCGGTCAAGTTG -3'
Posted On 2014-04-13