Mutagenetix > Incidental Mutation

Incidental Mutation 'R1514:Myo1d'

168634

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

039561-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1514 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80685908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 114 (Y114N)

Ref Sequence

ENSEMBL: ENSMUSP00000066948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]

AlphaFold

Q5SYD0

Predicted Effect

probably damaging
Transcript: ENSMUST00000041065
AA Change: Y114N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: Y114N

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000070997
AA Change: Y114N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: Y114N

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125944

Meta Mutation Damage Score

0.4843

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	T	A	10: 100,612,867	L147Q	probably damaging	Het
Abcb1a	A	G	5: 8,674,791	T75A	possibly damaging	Het
Acvr1	A	T	2: 58,447,585	L495*	probably null	Het
Add1	T	C	5: 34,610,617	I240T	probably benign	Het
Adgra2	C	A	8: 27,121,278	S870*	probably null	Het
Amer3	G	A	1: 34,579,327		probably benign	Het
Baz2b	A	T	2: 59,962,326	V486D	probably benign	Het
Bcorl1	T	A	X: 48,405,944	D1697E	probably damaging	Het
Cenpf	T	C	1: 189,679,141	D282G	possibly damaging	Het
Cep112	A	G	11: 108,472,054	D200G	probably damaging	Het
Clec4a4	C	T	6: 122,990,442	P26S	probably benign	Het
Crygf	A	C	1: 65,928,038	R102S	possibly damaging	Het
Cyp2b19	A	T	7: 26,767,160	E404D	probably benign	Het
Dcdc2a	A	G	13: 25,061,254	I105V	probably benign	Het
Dus4l	T	C	12: 31,640,939	M238V	probably damaging	Het
Eprs	G	A	1: 185,381,834	M326I	probably damaging	Het
Evpl	T	C	11: 116,223,835	T1010A	probably benign	Het
Fam124b	T	C	1: 80,200,431	T284A	possibly damaging	Het
Fam84a	C	T	12: 14,149,863	V288M	probably damaging	Het
Glb1l2	A	G	9: 26,769,124		probably benign	Het
Gm15922	G	A	7: 3,739,640	T23I	possibly damaging	Het
Gm16223	T	A	5: 42,067,955		probably null	Het
Gm438	T	C	4: 144,777,759	N274S	probably damaging	Het
Gm4952	T	A	19: 12,626,914	M230K	probably damaging	Het
Gm5828	C	A	1: 16,769,359		noncoding transcript	Het
Gm597	T	A	1: 28,778,748	T68S	possibly damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifna16	T	A	4: 88,676,742	T39S	possibly damaging	Het
Kcnc3	G	A	7: 44,595,603	G439D	probably damaging	Het
Kif1c	T	C	11: 70,705,729	S257P	probably damaging	Het
Kng1	A	G	16: 23,079,760	K456E	probably damaging	Het
Lpxn	T	C	19: 12,824,050	L142P	probably damaging	Het
Med23	A	G	10: 24,892,667		probably benign	Het
Mgea5	A	G	19: 45,776,931	S146P	probably damaging	Het
Mks1	A	T	11: 87,861,111	D369V	probably benign	Het
Npas2	A	G	1: 39,311,854	D126G	possibly damaging	Het
Olfr1314	T	C	2: 112,092,036	I222V	probably benign	Het
Olfr1420	A	G	19: 11,896,614	T198A	probably benign	Het
Olfr148	T	C	9: 39,613,696	I43T	probably damaging	Het
Onecut2	T	C	18: 64,341,580	F401L	possibly damaging	Het
Parp11	T	A	6: 127,474,293	F102Y	possibly damaging	Het
Pcnx	C	T	12: 81,918,798	H580Y	probably damaging	Het
Pde3b	A	G	7: 114,530,766	H852R	probably damaging	Het
Pou2af1	A	G	9: 51,233,208	T141A	probably benign	Het
Rgs22	A	C	15: 36,013,100	V1190G	probably benign	Het
Rnf112	T	C	11: 61,450,410	S450G	probably benign	Het
Rpgrip1l	A	T	8: 91,260,750	I893N	probably damaging	Het
Rps3a1	A	G	3: 86,138,527	V210A	probably benign	Het
Runx2	C	T	17: 44,735,337	A114T	possibly damaging	Het
Sardh	A	G	2: 27,197,690	V723A	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Secisbp2	A	G	13: 51,682,095	S742G	possibly damaging	Het
Selenow	G	T	7: 15,920,298		probably benign	Het
Slc30a4	A	G	2: 122,689,414	V226A	probably damaging	Het
Sntb2	A	G	8: 106,991,532	N291D	probably damaging	Het
Sorbs2	A	G	8: 45,769,829	T190A	probably damaging	Het
Specc1	T	A	11: 62,156,532	L909H	probably damaging	Het
Sprr1b	T	C	3: 92,437,107	*154W	probably null	Het
Taar4	T	A	10: 23,960,612	M40K	possibly damaging	Het
Ubr2	A	T	17: 47,000,823	L34H	probably damaging	Het
Ubxn6	T	C	17: 56,069,003	K386R	probably benign	Het
Vmn2r112	A	T	17: 22,602,844	T168S	probably benign	Het
Xirp2	A	T	2: 67,514,323	R2303*	probably null	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp13	G	T	17: 23,576,412	T395K	probably damaging	Het
Zfp281	A	G	1: 136,626,697	N471S	probably benign	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCAGGACACCTTCAACTATTGCAAAGT -3'
(R):5'- TGCGAGCACCCGACTCTGAT -3'

Sequencing Primer
(F):5'- TGTGCAATGTGAGAATCAAAGC -3'
(R):5'- gcattcaatttccatcaaccac -3'

Posted On

2014-04-13