Incidental Mutation 'R1514:Zbtb14'
ID168653
Institutional Source Beutler Lab
Gene Symbol Zbtb14
Ensembl Gene ENSMUSG00000049672
Gene Namezinc finger and BTB domain containing 14
SynonymsZfp161, b2b1982Clo, ZF5
MMRRC Submission 039561-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R1514 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location69383050-69390750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69388502 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 398 (F398L)
Ref Sequence ENSEMBL: ENSMUSP00000108296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062369] [ENSMUST00000112674] [ENSMUST00000112676]
Predicted Effect probably damaging
Transcript: ENSMUST00000062369
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054897
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112674
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108294
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112676
AA Change: F398L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108296
Gene: ENSMUSG00000049672
AA Change: F398L

DomainStartEndE-ValueType
BTB 36 132 8.8e-26 SMART
low complexity region 154 171 N/A INTRINSIC
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 3.95e-4 SMART
ZnF_C2H2 333 355 9.88e-5 SMART
ZnF_C2H2 361 383 2.2e-2 SMART
ZnF_C2H2 389 412 2.02e-1 SMART
low complexity region 428 444 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation show exencephaly, cardiac defects including valve abnormalities, double outlet right ventricle, perimembranous ventricular septal defect, and atrioventricular septal defect, and renal anomalies such as duplex kidney, hydronephrosis, and kidney cysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,867 L147Q probably damaging Het
Abcb1a A G 5: 8,674,791 T75A possibly damaging Het
Acvr1 A T 2: 58,447,585 L495* probably null Het
Add1 T C 5: 34,610,617 I240T probably benign Het
Adgra2 C A 8: 27,121,278 S870* probably null Het
Amer3 G A 1: 34,579,327 probably benign Het
Baz2b A T 2: 59,962,326 V486D probably benign Het
Bcorl1 T A X: 48,405,944 D1697E probably damaging Het
Cenpf T C 1: 189,679,141 D282G possibly damaging Het
Cep112 A G 11: 108,472,054 D200G probably damaging Het
Clec4a4 C T 6: 122,990,442 P26S probably benign Het
Crygf A C 1: 65,928,038 R102S possibly damaging Het
Cyp2b19 A T 7: 26,767,160 E404D probably benign Het
Dcdc2a A G 13: 25,061,254 I105V probably benign Het
Dus4l T C 12: 31,640,939 M238V probably damaging Het
Eprs G A 1: 185,381,834 M326I probably damaging Het
Evpl T C 11: 116,223,835 T1010A probably benign Het
Fam124b T C 1: 80,200,431 T284A possibly damaging Het
Fam84a C T 12: 14,149,863 V288M probably damaging Het
Glb1l2 A G 9: 26,769,124 probably benign Het
Gm15922 G A 7: 3,739,640 T23I possibly damaging Het
Gm16223 T A 5: 42,067,955 probably null Het
Gm438 T C 4: 144,777,759 N274S probably damaging Het
Gm4952 T A 19: 12,626,914 M230K probably damaging Het
Gm5828 C A 1: 16,769,359 noncoding transcript Het
Gm597 T A 1: 28,778,748 T68S possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna16 T A 4: 88,676,742 T39S possibly damaging Het
Kcnc3 G A 7: 44,595,603 G439D probably damaging Het
Kif1c T C 11: 70,705,729 S257P probably damaging Het
Kng1 A G 16: 23,079,760 K456E probably damaging Het
Lpxn T C 19: 12,824,050 L142P probably damaging Het
Med23 A G 10: 24,892,667 probably benign Het
Mgea5 A G 19: 45,776,931 S146P probably damaging Het
Mks1 A T 11: 87,861,111 D369V probably benign Het
Myo1d A T 11: 80,685,908 Y114N probably damaging Het
Npas2 A G 1: 39,311,854 D126G possibly damaging Het
Olfr1314 T C 2: 112,092,036 I222V probably benign Het
Olfr1420 A G 19: 11,896,614 T198A probably benign Het
Olfr148 T C 9: 39,613,696 I43T probably damaging Het
Onecut2 T C 18: 64,341,580 F401L possibly damaging Het
Parp11 T A 6: 127,474,293 F102Y possibly damaging Het
Pcnx C T 12: 81,918,798 H580Y probably damaging Het
Pde3b A G 7: 114,530,766 H852R probably damaging Het
Pou2af1 A G 9: 51,233,208 T141A probably benign Het
Rgs22 A C 15: 36,013,100 V1190G probably benign Het
Rnf112 T C 11: 61,450,410 S450G probably benign Het
Rpgrip1l A T 8: 91,260,750 I893N probably damaging Het
Rps3a1 A G 3: 86,138,527 V210A probably benign Het
Runx2 C T 17: 44,735,337 A114T possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Secisbp2 A G 13: 51,682,095 S742G possibly damaging Het
Selenow G T 7: 15,920,298 probably benign Het
Slc30a4 A G 2: 122,689,414 V226A probably damaging Het
Sntb2 A G 8: 106,991,532 N291D probably damaging Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Specc1 T A 11: 62,156,532 L909H probably damaging Het
Sprr1b T C 3: 92,437,107 *154W probably null Het
Taar4 T A 10: 23,960,612 M40K possibly damaging Het
Ubr2 A T 17: 47,000,823 L34H probably damaging Het
Ubxn6 T C 17: 56,069,003 K386R probably benign Het
Vmn2r112 A T 17: 22,602,844 T168S probably benign Het
Xirp2 A T 2: 67,514,323 R2303* probably null Het
Zfp13 G T 17: 23,576,412 T395K probably damaging Het
Zfp281 A G 1: 136,626,697 N471S probably benign Het
Other mutations in Zbtb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL01623:Zbtb14 APN 17 69388189 missense probably benign 0.04
IGL02477:Zbtb14 APN 17 69387695 missense probably benign 0.00
PIT4687001:Zbtb14 UTSW 17 69388307 nonsense probably null
R0736:Zbtb14 UTSW 17 69387802 missense possibly damaging 0.66
R0811:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0812:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0829:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0866:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0946:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R0947:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1052:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1053:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1056:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1076:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1187:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1374:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1471:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1505:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1507:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1508:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1509:Zbtb14 UTSW 17 69387764 missense probably benign 0.00
R1680:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1691:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R1712:Zbtb14 UTSW 17 69387580 missense probably damaging 1.00
R1907:Zbtb14 UTSW 17 69387390 missense possibly damaging 0.91
R1981:Zbtb14 UTSW 17 69388502 missense probably damaging 1.00
R2916:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R2918:Zbtb14 UTSW 17 69388219 missense probably damaging 1.00
R4589:Zbtb14 UTSW 17 69388470 missense probably damaging 1.00
R4622:Zbtb14 UTSW 17 69388347 missense possibly damaging 0.80
R4812:Zbtb14 UTSW 17 69387582 missense probably damaging 1.00
R6246:Zbtb14 UTSW 17 69387483 missense possibly damaging 0.46
R6889:Zbtb14 UTSW 17 69387679 missense probably damaging 1.00
R7575:Zbtb14 UTSW 17 69387447 missense probably damaging 0.98
R7716:Zbtb14 UTSW 17 69387420 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCGAGGTGTGCGGAAAGTCATTC -3'
(R):5'- GCCACAAAGCGGTCAAAGGTGTTC -3'

Sequencing Primer
(F):5'- CGGAAAGTCATTCATCCGC -3'
(R):5'- AGGTGTTCACTGACTACAGC -3'
Posted On2014-04-13