Incidental Mutation 'R1514:Olfr1420'
ID168655
Institutional Source Beutler Lab
Gene Symbol Olfr1420
Ensembl Gene ENSMUSG00000060878
Gene Nameolfactory receptor 1420
SynonymsMOR266-4, GA_x6K02T2RE5P-2247227-2248156
MMRRC Submission 039561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1514 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11886565-11898079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11896614 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000149208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072784] [ENSMUST00000217281]
Predicted Effect probably benign
Transcript: ENSMUST00000072784
AA Change: T198A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072563
Gene: ENSMUSG00000060878
AA Change: T198A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-54 PFAM
Pfam:7tm_1 41 291 3.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215766
Predicted Effect probably benign
Transcript: ENSMUST00000217281
AA Change: T198A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0994 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,867 L147Q probably damaging Het
Abcb1a A G 5: 8,674,791 T75A possibly damaging Het
Acvr1 A T 2: 58,447,585 L495* probably null Het
Add1 T C 5: 34,610,617 I240T probably benign Het
Adgra2 C A 8: 27,121,278 S870* probably null Het
Amer3 G A 1: 34,579,327 probably benign Het
Baz2b A T 2: 59,962,326 V486D probably benign Het
Bcorl1 T A X: 48,405,944 D1697E probably damaging Het
Cenpf T C 1: 189,679,141 D282G possibly damaging Het
Cep112 A G 11: 108,472,054 D200G probably damaging Het
Clec4a4 C T 6: 122,990,442 P26S probably benign Het
Crygf A C 1: 65,928,038 R102S possibly damaging Het
Cyp2b19 A T 7: 26,767,160 E404D probably benign Het
Dcdc2a A G 13: 25,061,254 I105V probably benign Het
Dus4l T C 12: 31,640,939 M238V probably damaging Het
Eprs G A 1: 185,381,834 M326I probably damaging Het
Evpl T C 11: 116,223,835 T1010A probably benign Het
Fam124b T C 1: 80,200,431 T284A possibly damaging Het
Fam84a C T 12: 14,149,863 V288M probably damaging Het
Glb1l2 A G 9: 26,769,124 probably benign Het
Gm15922 G A 7: 3,739,640 T23I possibly damaging Het
Gm16223 T A 5: 42,067,955 probably null Het
Gm438 T C 4: 144,777,759 N274S probably damaging Het
Gm4952 T A 19: 12,626,914 M230K probably damaging Het
Gm5828 C A 1: 16,769,359 noncoding transcript Het
Gm597 T A 1: 28,778,748 T68S possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna16 T A 4: 88,676,742 T39S possibly damaging Het
Kcnc3 G A 7: 44,595,603 G439D probably damaging Het
Kif1c T C 11: 70,705,729 S257P probably damaging Het
Kng1 A G 16: 23,079,760 K456E probably damaging Het
Lpxn T C 19: 12,824,050 L142P probably damaging Het
Med23 A G 10: 24,892,667 probably benign Het
Mgea5 A G 19: 45,776,931 S146P probably damaging Het
Mks1 A T 11: 87,861,111 D369V probably benign Het
Myo1d A T 11: 80,685,908 Y114N probably damaging Het
Npas2 A G 1: 39,311,854 D126G possibly damaging Het
Olfr1314 T C 2: 112,092,036 I222V probably benign Het
Olfr148 T C 9: 39,613,696 I43T probably damaging Het
Onecut2 T C 18: 64,341,580 F401L possibly damaging Het
Parp11 T A 6: 127,474,293 F102Y possibly damaging Het
Pcnx C T 12: 81,918,798 H580Y probably damaging Het
Pde3b A G 7: 114,530,766 H852R probably damaging Het
Pou2af1 A G 9: 51,233,208 T141A probably benign Het
Rgs22 A C 15: 36,013,100 V1190G probably benign Het
Rnf112 T C 11: 61,450,410 S450G probably benign Het
Rpgrip1l A T 8: 91,260,750 I893N probably damaging Het
Rps3a1 A G 3: 86,138,527 V210A probably benign Het
Runx2 C T 17: 44,735,337 A114T possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Secisbp2 A G 13: 51,682,095 S742G possibly damaging Het
Selenow G T 7: 15,920,298 probably benign Het
Slc30a4 A G 2: 122,689,414 V226A probably damaging Het
Sntb2 A G 8: 106,991,532 N291D probably damaging Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Specc1 T A 11: 62,156,532 L909H probably damaging Het
Sprr1b T C 3: 92,437,107 *154W probably null Het
Taar4 T A 10: 23,960,612 M40K possibly damaging Het
Ubr2 A T 17: 47,000,823 L34H probably damaging Het
Ubxn6 T C 17: 56,069,003 K386R probably benign Het
Vmn2r112 A T 17: 22,602,844 T168S probably benign Het
Xirp2 A T 2: 67,514,323 R2303* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp13 G T 17: 23,576,412 T395K probably damaging Het
Zfp281 A G 1: 136,626,697 N471S probably benign Het
Other mutations in Olfr1420
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr1420 APN 19 11896822 missense probably benign 0.06
IGL02703:Olfr1420 APN 19 11896242 missense possibly damaging 0.96
IGL02948:Olfr1420 APN 19 11896781 nonsense probably null
R1539:Olfr1420 UTSW 19 11896491 missense possibly damaging 0.88
R1852:Olfr1420 UTSW 19 11896885 missense probably damaging 1.00
R1903:Olfr1420 UTSW 19 11896549 missense probably benign 0.24
R2061:Olfr1420 UTSW 19 11896557 missense probably damaging 0.98
R3768:Olfr1420 UTSW 19 11896312 missense probably damaging 0.99
R3977:Olfr1420 UTSW 19 11896516 missense probably damaging 1.00
R4479:Olfr1420 UTSW 19 11896558 missense probably damaging 0.99
R4592:Olfr1420 UTSW 19 11896762 missense probably benign
R5934:Olfr1420 UTSW 19 11896929 missense probably benign
R6058:Olfr1420 UTSW 19 11896024 start codon destroyed probably null 1.00
R6536:Olfr1420 UTSW 19 11896396 missense probably benign 0.05
R7752:Olfr1420 UTSW 19 11896534 missense probably benign 0.01
R7901:Olfr1420 UTSW 19 11896534 missense probably benign 0.01
R8250:Olfr1420 UTSW 19 11896377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATTGCACCACTGGCCTTG -3'
(R):5'- TGTAGGAGGACCACTACGATGTGAG -3'

Sequencing Primer
(F):5'- GGGGAAAACTCCTGTTTCCATC -3'
(R):5'- CCACTACGATGTGAGAGGAGC -3'
Posted On2014-04-13