Incidental Mutation 'R1514:Lpxn'
ID168657
Institutional Source Beutler Lab
Gene Symbol Lpxn
Ensembl Gene ENSMUSG00000024696
Gene Nameleupaxin
Synonyms4933402K05Rik, A530083L21Rik
MMRRC Submission 039561-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1514 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12798606-12833807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12824050 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 142 (L142P)
Ref Sequence ENSEMBL: ENSMUSP00000025601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025601]
Predicted Effect probably damaging
Transcript: ENSMUST00000025601
AA Change: L142P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025601
Gene: ENSMUSG00000024696
AA Change: L142P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
LIM 151 202 3.17e-17 SMART
LIM 210 261 1.98e-18 SMART
LIM 269 320 3.26e-19 SMART
LIM 328 379 3.34e-16 SMART
Meta Mutation Damage Score 0.3371 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is preferentially expressed in hematopoietic cells and belongs to the paxillin protein family. Similar to other members of this focal-adhesion-associated adaptor-protein family, it has four leucine-rich LD-motifs in the N-terminus and four LIM domains in the C-terminus. It may function in cell type-specific signaling by associating with PYK2, a member of focal adhesion kinase family. As a substrate for a tyrosine kinase in lymphoid cells, this protein may also function in, and be regulated by, tyrosine kinase activity. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,612,867 L147Q probably damaging Het
Abcb1a A G 5: 8,674,791 T75A possibly damaging Het
Acvr1 A T 2: 58,447,585 L495* probably null Het
Add1 T C 5: 34,610,617 I240T probably benign Het
Adgra2 C A 8: 27,121,278 S870* probably null Het
Amer3 G A 1: 34,579,327 probably benign Het
Baz2b A T 2: 59,962,326 V486D probably benign Het
Bcorl1 T A X: 48,405,944 D1697E probably damaging Het
Cenpf T C 1: 189,679,141 D282G possibly damaging Het
Cep112 A G 11: 108,472,054 D200G probably damaging Het
Clec4a4 C T 6: 122,990,442 P26S probably benign Het
Crygf A C 1: 65,928,038 R102S possibly damaging Het
Cyp2b19 A T 7: 26,767,160 E404D probably benign Het
Dcdc2a A G 13: 25,061,254 I105V probably benign Het
Dus4l T C 12: 31,640,939 M238V probably damaging Het
Eprs G A 1: 185,381,834 M326I probably damaging Het
Evpl T C 11: 116,223,835 T1010A probably benign Het
Fam124b T C 1: 80,200,431 T284A possibly damaging Het
Fam84a C T 12: 14,149,863 V288M probably damaging Het
Glb1l2 A G 9: 26,769,124 probably benign Het
Gm15922 G A 7: 3,739,640 T23I possibly damaging Het
Gm16223 T A 5: 42,067,955 probably null Het
Gm438 T C 4: 144,777,759 N274S probably damaging Het
Gm4952 T A 19: 12,626,914 M230K probably damaging Het
Gm5828 C A 1: 16,769,359 noncoding transcript Het
Gm597 T A 1: 28,778,748 T68S possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna16 T A 4: 88,676,742 T39S possibly damaging Het
Kcnc3 G A 7: 44,595,603 G439D probably damaging Het
Kif1c T C 11: 70,705,729 S257P probably damaging Het
Kng1 A G 16: 23,079,760 K456E probably damaging Het
Med23 A G 10: 24,892,667 probably benign Het
Mgea5 A G 19: 45,776,931 S146P probably damaging Het
Mks1 A T 11: 87,861,111 D369V probably benign Het
Myo1d A T 11: 80,685,908 Y114N probably damaging Het
Npas2 A G 1: 39,311,854 D126G possibly damaging Het
Olfr1314 T C 2: 112,092,036 I222V probably benign Het
Olfr1420 A G 19: 11,896,614 T198A probably benign Het
Olfr148 T C 9: 39,613,696 I43T probably damaging Het
Onecut2 T C 18: 64,341,580 F401L possibly damaging Het
Parp11 T A 6: 127,474,293 F102Y possibly damaging Het
Pcnx C T 12: 81,918,798 H580Y probably damaging Het
Pde3b A G 7: 114,530,766 H852R probably damaging Het
Pou2af1 A G 9: 51,233,208 T141A probably benign Het
Rgs22 A C 15: 36,013,100 V1190G probably benign Het
Rnf112 T C 11: 61,450,410 S450G probably benign Het
Rpgrip1l A T 8: 91,260,750 I893N probably damaging Het
Rps3a1 A G 3: 86,138,527 V210A probably benign Het
Runx2 C T 17: 44,735,337 A114T possibly damaging Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Secisbp2 A G 13: 51,682,095 S742G possibly damaging Het
Selenow G T 7: 15,920,298 probably benign Het
Slc30a4 A G 2: 122,689,414 V226A probably damaging Het
Sntb2 A G 8: 106,991,532 N291D probably damaging Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Specc1 T A 11: 62,156,532 L909H probably damaging Het
Sprr1b T C 3: 92,437,107 *154W probably null Het
Taar4 T A 10: 23,960,612 M40K possibly damaging Het
Ubr2 A T 17: 47,000,823 L34H probably damaging Het
Ubxn6 T C 17: 56,069,003 K386R probably benign Het
Vmn2r112 A T 17: 22,602,844 T168S probably benign Het
Xirp2 A T 2: 67,514,323 R2303* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp13 G T 17: 23,576,412 T395K probably damaging Het
Zfp281 A G 1: 136,626,697 N471S probably benign Het
Other mutations in Lpxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Lpxn APN 19 12833086 missense probably damaging 0.99
IGL03088:Lpxn APN 19 12833211 missense probably damaging 1.00
IGL03203:Lpxn APN 19 12819406 missense probably benign 0.01
mascherano UTSW 19 12833172 missense probably damaging 0.99
R0848:Lpxn UTSW 19 12804037 missense probably benign
R1532:Lpxn UTSW 19 12804092 critical splice donor site probably null
R1880:Lpxn UTSW 19 12804088 missense probably benign 0.17
R1937:Lpxn UTSW 19 12824910 missense probably benign 0.00
R2182:Lpxn UTSW 19 12832758 critical splice donor site probably null
R2897:Lpxn UTSW 19 12819358 missense probably benign 0.01
R4194:Lpxn UTSW 19 12833235 missense probably damaging 1.00
R4576:Lpxn UTSW 19 12833290 missense probably benign 0.17
R4844:Lpxn UTSW 19 12833172 missense probably damaging 0.99
R5567:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R5570:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R6060:Lpxn UTSW 19 12833125 missense probably damaging 1.00
R6366:Lpxn UTSW 19 12824799 missense probably benign 0.12
R6615:Lpxn UTSW 19 12824799 missense probably benign 0.12
R7116:Lpxn UTSW 19 12811258 missense probably benign 0.28
R7135:Lpxn UTSW 19 12833319 missense probably damaging 1.00
R7808:Lpxn UTSW 19 12824821 missense possibly damaging 0.55
R8290:Lpxn UTSW 19 12832688 missense probably damaging 1.00
Z1176:Lpxn UTSW 19 12824947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGCACCTTGAAGGAAGGTTAG -3'
(R):5'- AGGTAATCTCAGTAGTGGCAGTGAACA -3'

Sequencing Primer
(F):5'- CAAGATCTGTCATTGGACGTGAAC -3'
(R):5'- tcccccttgcttcttacttac -3'
Posted On2014-04-13