Incidental Mutation 'R1499:Klk1b26'
ID168689
Institutional Source Beutler Lab
Gene Symbol Klk1b26
Ensembl Gene ENSMUSG00000053719
Gene Namekallikrein 1-related petidase b26
SynonymsEGF-BP type B, Egfbp2, PRECE-2, Klk26, mGK-26
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44012168-44016968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44016386 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 207 (D207E)
Ref Sequence ENSEMBL: ENSMUSP00000047488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048945]
Predicted Effect probably benign
Transcript: ENSMUST00000048945
AA Change: D207E

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047488
Gene: ENSMUSG00000053719
AA Change: D207E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 2.29e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205780
Meta Mutation Damage Score 0.5121 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. The kallikrein genes are present in a large gene cluster on chromosome 7. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of this gene in the submandibular gland is sexually dimorphic likely due to both transcriptional and post-transcriptional regulation. This gene is thought to be distinct from the Egfbp2 gene (Gene ID: 13647), with which it shares 98% identity (PMIDs: 1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fgf8 C A 19: 45,742,347 V80F possibly damaging Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grik2 A C 10: 49,132,775 S739A probably damaging Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Olfr429 T A 1: 174,089,247 L69* probably null Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Pum1 T C 4: 130,719,256 S209P probably damaging Het
Qtrt2 A T 16: 43,868,974 F220L probably benign Het
Rgs9 A G 11: 109,268,921 probably null Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Stag1 A G 9: 100,855,832 E414G possibly damaging Het
Stag1 A T 9: 100,887,373 probably benign Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Klk1b26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Klk1b26 APN 7 44016885 missense probably benign 0.00
IGL02179:Klk1b26 APN 7 44016312 missense probably benign
IGL03190:Klk1b26 APN 7 44012727 missense possibly damaging 0.76
R0391:Klk1b26 UTSW 7 44012727 missense probably damaging 1.00
R0483:Klk1b26 UTSW 7 44016348 missense probably benign 0.15
R1549:Klk1b26 UTSW 7 44016402 splice site probably benign
R1991:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2103:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2998:Klk1b26 UTSW 7 44016798 missense probably benign 0.26
R3414:Klk1b26 UTSW 7 44016873 missense probably benign
R4990:Klk1b26 UTSW 7 44016249 splice site probably null
R4991:Klk1b26 UTSW 7 44016249 splice site probably null
R5527:Klk1b26 UTSW 7 44012763 missense probably benign 0.00
R5796:Klk1b26 UTSW 7 44016328 missense probably damaging 1.00
R6816:Klk1b26 UTSW 7 44016868 missense probably benign 0.00
R6938:Klk1b26 UTSW 7 44016294 missense probably benign 0.00
R7197:Klk1b26 UTSW 7 44016397 critical splice donor site probably null
R7243:Klk1b26 UTSW 7 44016267 missense not run
R7243:Klk1b26 UTSW 7 44016913 missense probably damaging 1.00
R7253:Klk1b26 UTSW 7 44014789 missense possibly damaging 0.66
R7423:Klk1b26 UTSW 7 44014769 missense probably damaging 0.99
R8270:Klk1b26 UTSW 7 44016120 missense probably benign 0.08
R8342:Klk1b26 UTSW 7 44016084 missense probably damaging 0.98
Z1088:Klk1b26 UTSW 7 44015996 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTTCTCCAAGGAACAACGCTG -3'
(R):5'- GACCACCTGGAACTGATTCCCAAG -3'

Sequencing Primer
(F):5'- ACAACGCTGAGTGTGGG -3'
(R):5'- TGGATTGGACAGTCCCCTAAG -3'
Posted On2014-04-13