Incidental Mutation 'R1499:Stag1'
ID168704
Institutional Source Beutler Lab
Gene Symbol Stag1
Ensembl Gene ENSMUSG00000037286
Gene Namestromal antigen 1
SynonymsScc3, SA-1
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100597798-100959375 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 100887373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000155108]
Predicted Effect probably benign
Transcript: ENSMUST00000041418
SMART Domains Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-50 PFAM
SCOP:d1qbkb_ 279 850 4e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123302
SMART Domains Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 2.9e-51 PFAM
low complexity region 303 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129269
SMART Domains Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 160 274 3.8e-41 PFAM
SCOP:d1qbkb_ 279 850 3e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143955
SMART Domains Protein: ENSMUSP00000115460
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 232 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146934
SMART Domains Protein: ENSMUSP00000120974
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 673 692 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149771
Predicted Effect probably benign
Transcript: ENSMUST00000155108
SMART Domains Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fgf8 C A 19: 45,742,347 V80F possibly damaging Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grik2 A C 10: 49,132,775 S739A probably damaging Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Klk1b26 C A 7: 44,016,386 D207E probably benign Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Olfr429 T A 1: 174,089,247 L69* probably null Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Pum1 T C 4: 130,719,256 S209P probably damaging Het
Qtrt2 A T 16: 43,868,974 F220L probably benign Het
Rgs9 A G 11: 109,268,921 probably null Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Stag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Stag1 APN 9 100776808 missense probably damaging 1.00
IGL01010:Stag1 APN 9 100945933 missense probably benign 0.06
IGL01012:Stag1 APN 9 100855859 missense possibly damaging 0.47
IGL01025:Stag1 APN 9 100951657 missense possibly damaging 0.95
IGL01307:Stag1 APN 9 100951788 intron probably benign
IGL02149:Stag1 APN 9 100887389 missense probably benign 0.09
IGL02608:Stag1 APN 9 100757769 missense probably null 0.99
IGL03008:Stag1 APN 9 100776791 missense probably damaging 1.00
IGL03210:Stag1 APN 9 100845076 missense possibly damaging 0.63
eto_o UTSW 9 100796716 missense probably damaging 1.00
PIT4280001:Stag1 UTSW 9 100942716 missense possibly damaging 0.95
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0349:Stag1 UTSW 9 100776784 missense probably damaging 0.98
R0479:Stag1 UTSW 9 100928091 missense probably benign 0.00
R0531:Stag1 UTSW 9 100954247 makesense probably null
R0962:Stag1 UTSW 9 100796827 missense probably damaging 1.00
R0976:Stag1 UTSW 9 100776824 missense probably damaging 0.98
R0976:Stag1 UTSW 9 100930016 critical splice donor site probably null
R1170:Stag1 UTSW 9 100888453 intron probably benign
R1499:Stag1 UTSW 9 100855832 missense possibly damaging 0.77
R1644:Stag1 UTSW 9 100880900 intron probably benign
R1747:Stag1 UTSW 9 100888300 missense probably benign
R1799:Stag1 UTSW 9 100953462 splice site probably null
R1807:Stag1 UTSW 9 100908666 missense probably benign 0.34
R1978:Stag1 UTSW 9 100888086 missense probably benign 0.03
R2029:Stag1 UTSW 9 100786687 missense probably damaging 1.00
R2161:Stag1 UTSW 9 100889595 missense probably damaging 1.00
R2300:Stag1 UTSW 9 100712500 missense possibly damaging 0.92
R2327:Stag1 UTSW 9 100786613 missense possibly damaging 0.81
R2426:Stag1 UTSW 9 100845116 critical splice donor site probably null
R2448:Stag1 UTSW 9 100888409 missense probably benign 0.42
R2504:Stag1 UTSW 9 100866210 missense probably damaging 0.99
R3713:Stag1 UTSW 9 100889618 missense probably benign 0.01
R3835:Stag1 UTSW 9 100737982 missense probably damaging 0.97
R3862:Stag1 UTSW 9 100944785 missense probably benign 0.02
R4398:Stag1 UTSW 9 100956606 utr 3 prime probably benign
R4568:Stag1 UTSW 9 100848669 missense probably damaging 1.00
R4651:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4652:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4653:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4675:Stag1 UTSW 9 100848705 missense probably damaging 1.00
R4709:Stag1 UTSW 9 100738039 missense probably damaging 0.99
R4924:Stag1 UTSW 9 100796755 missense possibly damaging 0.67
R5018:Stag1 UTSW 9 100951619 missense probably benign 0.00
R5435:Stag1 UTSW 9 100953550 missense probably benign 0.03
R5460:Stag1 UTSW 9 100956453 splice site probably null
R5805:Stag1 UTSW 9 100796778 missense probably damaging 1.00
R6127:Stag1 UTSW 9 100951697 missense probably benign 0.05
R6313:Stag1 UTSW 9 100757733 missense probably damaging 1.00
R6597:Stag1 UTSW 9 100887420 missense probably benign 0.01
R6807:Stag1 UTSW 9 100944850 missense probably damaging 1.00
R7099:Stag1 UTSW 9 100944826 missense probably benign 0.02
R7167:Stag1 UTSW 9 100945889 missense probably benign 0.05
R7395:Stag1 UTSW 9 100796728 missense probably damaging 0.99
R7504:Stag1 UTSW 9 100888328 missense probably benign 0.09
R7663:Stag1 UTSW 9 100738138 missense probably damaging 0.98
R7769:Stag1 UTSW 9 100944827 missense possibly damaging 0.86
R8245:Stag1 UTSW 9 100929893 missense probably benign 0.01
R8343:Stag1 UTSW 9 100757766 missense possibly damaging 0.95
R8473:Stag1 UTSW 9 100880787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATTCTagcaagttctaagacaaccagg -3'
(R):5'- GCATGAAAGCAAACTCAAGGACATATTATCAC -3'

Sequencing Primer
(F):5'- accagggctattcagagaaac -3'
(R):5'- CATTGGCAGATGACATACCAAG -3'
Posted On2014-04-13