Incidental Mutation 'R1499:Grik2'
ID168710
Institutional Source Beutler Lab
Gene Symbol Grik2
Ensembl Gene ENSMUSG00000056073
Gene Nameglutamate receptor, ionotropic, kainate 2 (beta 2)
SynonymsGlurbeta2, Glur-6, Glur6
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location49094833-49788766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49132775 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 739 (S739A)
Ref Sequence ENSEMBL: ENSMUSP00000151921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218823]
Predicted Effect probably damaging
Transcript: ENSMUST00000079751
AA Change: S739A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: S739A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105484
AA Change: S739A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: S739A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105485
AA Change: S739A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: S739A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105486
AA Change: S739A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: S739A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 3.8e-11 PFAM
Pfam:ANF_receptor 52 395 1.5e-74 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 6e-13 BLAST
low complexity region 875 891 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105487
AA Change: S739A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: S739A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217673
Predicted Effect probably damaging
Transcript: ENSMUST00000218441
AA Change: S739A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000218598
AA Change: S739A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000218823
AA Change: S739A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect unknown
Transcript: ENSMUST00000219509
AA Change: S178A
Meta Mutation Damage Score 0.2308 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fgf8 C A 19: 45,742,347 V80F possibly damaging Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Klk1b26 C A 7: 44,016,386 D207E probably benign Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Olfr429 T A 1: 174,089,247 L69* probably null Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Pum1 T C 4: 130,719,256 S209P probably damaging Het
Qtrt2 A T 16: 43,868,974 F220L probably benign Het
Rgs9 A G 11: 109,268,921 probably null Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Stag1 A G 9: 100,855,832 E414G possibly damaging Het
Stag1 A T 9: 100,887,373 probably benign Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Grik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Grik2 APN 10 49355928 missense possibly damaging 0.95
IGL00979:Grik2 APN 10 49355938 missense probably damaging 1.00
IGL01012:Grik2 APN 10 49272956 missense probably damaging 1.00
IGL01302:Grik2 APN 10 49244330 missense probably damaging 0.99
IGL01657:Grik2 APN 10 49527986 critical splice donor site probably null
IGL02162:Grik2 APN 10 49422575 missense possibly damaging 0.77
IGL02317:Grik2 APN 10 49422615 missense probably benign 0.16
IGL02512:Grik2 APN 10 49355912 missense probably benign 0.00
IGL02650:Grik2 APN 10 49101235 missense probably benign 0.03
IGL03283:Grik2 APN 10 49578269 missense probably benign 0.00
BB004:Grik2 UTSW 10 49240794 missense probably damaging 1.00
BB014:Grik2 UTSW 10 49240794 missense probably damaging 1.00
R0325:Grik2 UTSW 10 49240725 missense probably damaging 1.00
R0492:Grik2 UTSW 10 49101164 missense probably damaging 0.99
R0601:Grik2 UTSW 10 49422597 missense probably damaging 1.00
R0844:Grik2 UTSW 10 49101115 missense possibly damaging 0.81
R1333:Grik2 UTSW 10 49527991 missense probably damaging 0.98
R1660:Grik2 UTSW 10 49244343 nonsense probably null
R1721:Grik2 UTSW 10 49523746 missense possibly damaging 0.93
R1966:Grik2 UTSW 10 49355909 missense probably damaging 1.00
R1974:Grik2 UTSW 10 49132827 missense possibly damaging 0.85
R2246:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R3103:Grik2 UTSW 10 49240772 missense probably damaging 1.00
R3974:Grik2 UTSW 10 49422654 missense probably damaging 1.00
R4592:Grik2 UTSW 10 49422615 missense possibly damaging 0.48
R4658:Grik2 UTSW 10 49523792 missense possibly damaging 0.71
R4748:Grik2 UTSW 10 49535341 missense possibly damaging 0.87
R4935:Grik2 UTSW 10 49240730 missense probably damaging 1.00
R4977:Grik2 UTSW 10 49132745 missense probably damaging 1.00
R5103:Grik2 UTSW 10 49496109 missense probably benign 0.33
R5330:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5331:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5736:Grik2 UTSW 10 49404410 missense probably damaging 0.96
R5740:Grik2 UTSW 10 49113477 missense probably damaging 0.99
R5747:Grik2 UTSW 10 49523774 missense probably benign
R6015:Grik2 UTSW 10 49523863 splice site probably null
R6311:Grik2 UTSW 10 49578138 missense probably damaging 0.98
R6474:Grik2 UTSW 10 49132680 missense probably benign
R6504:Grik2 UTSW 10 49356102 missense probably damaging 1.00
R6591:Grik2 UTSW 10 49272925 nonsense probably null
R6691:Grik2 UTSW 10 49272925 nonsense probably null
R6776:Grik2 UTSW 10 49355989 missense probably damaging 1.00
R7015:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R7094:Grik2 UTSW 10 49355916 missense possibly damaging 0.75
R7153:Grik2 UTSW 10 49535367 missense probably benign 0.00
R7229:Grik2 UTSW 10 49101416 splice site probably null
R7402:Grik2 UTSW 10 49535397 missense probably damaging 1.00
R7473:Grik2 UTSW 10 49113522 missense probably benign 0.22
R7514:Grik2 UTSW 10 49523808 missense probably damaging 0.99
R7526:Grik2 UTSW 10 49523822 missense possibly damaging 0.56
R7657:Grik2 UTSW 10 49783151 missense probably benign 0.11
R7681:Grik2 UTSW 10 49244380 missense probably damaging 1.00
R7714:Grik2 UTSW 10 49419696 missense probably damaging 0.97
R7927:Grik2 UTSW 10 49240794 missense probably damaging 1.00
R7952:Grik2 UTSW 10 49422537 missense probably benign 0.15
R7979:Grik2 UTSW 10 49404342 missense probably benign 0.01
R8062:Grik2 UTSW 10 49240767 missense probably damaging 1.00
R8222:Grik2 UTSW 10 49573648 missense probably benign 0.29
R8406:Grik2 UTSW 10 49272767 missense probably damaging 1.00
RF008:Grik2 UTSW 10 49244384 missense probably damaging 1.00
X0062:Grik2 UTSW 10 49272920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCAGTTTGGAGCCTGAGACCG -3'
(R):5'- CCTGACAGTGTCAATCTGAGTCCAGTA -3'

Sequencing Primer
(F):5'- CCTGCTCTTATAGATAAAAGAGTTCC -3'
(R):5'- CAGTCAGAAGACTCTTCATTAAGCTC -3'
Posted On2014-04-13