Incidental Mutation 'R1499:Rgs9'
ID168720
Institutional Source Beutler Lab
Gene Symbol Rgs9
Ensembl Gene ENSMUSG00000020599
Gene Nameregulator of G-protein signaling 9
SynonymsRgs9-2, RGS9-1
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109225355-109298129 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 109268921 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020920] [ENSMUST00000020920] [ENSMUST00000106704] [ENSMUST00000106704] [ENSMUST00000106706] [ENSMUST00000106706]
Predicted Effect probably null
Transcript: ENSMUST00000020920
SMART Domains Protein: ENSMUSP00000020920
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
low complexity region 486 504 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000020920
SMART Domains Protein: ENSMUSP00000020920
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
low complexity region 486 504 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106704
SMART Domains Protein: ENSMUSP00000102315
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
Blast:G_gamma 154 229 4e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000106704
SMART Domains Protein: ENSMUSP00000102315
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
Blast:G_gamma 154 229 4e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000106706
SMART Domains Protein: ENSMUSP00000102317
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106706
SMART Domains Protein: ENSMUSP00000102317
Gene: ENSMUSG00000020599

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, relative to wild-type, homozygous null photoreceptors display abnormally retarded recovery of their light responses, and slowed rates of GTP hydrolysis by transducin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fgf8 C A 19: 45,742,347 V80F possibly damaging Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grik2 A C 10: 49,132,775 S739A probably damaging Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Klk1b26 C A 7: 44,016,386 D207E probably benign Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Olfr429 T A 1: 174,089,247 L69* probably null Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Pum1 T C 4: 130,719,256 S209P probably damaging Het
Qtrt2 A T 16: 43,868,974 F220L probably benign Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Stag1 A T 9: 100,887,373 probably benign Het
Stag1 A G 9: 100,855,832 E414G possibly damaging Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Rgs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Rgs9 APN 11 109249049 splice site probably benign
IGL01949:Rgs9 APN 11 109259834 critical splice donor site probably null
IGL02479:Rgs9 APN 11 109225652 missense possibly damaging 0.51
IGL03170:Rgs9 APN 11 109259855 missense probably benign 0.10
R1368:Rgs9 UTSW 11 109248151 missense probably benign 0.00
R1780:Rgs9 UTSW 11 109239499 nonsense probably null
R2422:Rgs9 UTSW 11 109225777 critical splice acceptor site probably null
R2509:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2510:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2511:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R3932:Rgs9 UTSW 11 109275813 splice site probably benign
R4179:Rgs9 UTSW 11 109281448 critical splice donor site probably null
R4801:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4802:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4928:Rgs9 UTSW 11 109225744 missense probably benign 0.08
R5073:Rgs9 UTSW 11 109227331 missense probably benign 0.03
R5209:Rgs9 UTSW 11 109239594 critical splice acceptor site probably null
R5286:Rgs9 UTSW 11 109239451 splice site probably null
R5449:Rgs9 UTSW 11 109225744 missense probably benign
R6046:Rgs9 UTSW 11 109239560 missense probably damaging 1.00
R6267:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R6296:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R7325:Rgs9 UTSW 11 109276581 missense probably damaging 1.00
R7453:Rgs9 UTSW 11 109227268 missense probably damaging 1.00
R7864:Rgs9 UTSW 11 109275620 missense probably damaging 1.00
R8035:Rgs9 UTSW 11 109273324 missense probably benign 0.28
R8885:Rgs9 UTSW 11 109275623 missense not run
Z1177:Rgs9 UTSW 11 109239592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACAGACAAGCTGTAAGGACCC -3'
(R):5'- TGTTAAGGAGCCCACCAAGACAAAG -3'

Sequencing Primer
(F):5'- GCTGTAAGGACCCCACCAAG -3'
(R):5'- ccaagttgctaggatcgaatg -3'
Posted On2014-04-13