Mutagenetix > Incidental Mutations

Incidental Mutation 'R1499:Sacs'

168729

Institutional Source

Beutler Lab

Gene Symbol

Sacs

Ensembl Gene

ENSMUSG00000048279

Gene Name

sacsin

Synonyms

E130115J16Rik

MMRRC Submission

039550-MU

Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1499 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61138457-61240695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61213704 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 4400 (F4400I)

Ref Sequence

ENSEMBL: ENSMUSP00000113377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]

Predicted Effect

probably benign
Transcript: ENSMUST00000089394

SMART Domains

Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119943
AA Change: F4400I

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: F4400I

Domain	Start	End	E-Value	Type
internal_repeat_1	61	514	1.35e-52	PROSPERO
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC
low complexity region	1019	1033	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1526	1537	N/A	INTRINSIC
low complexity region	2454	2463	N/A	INTRINSIC
internal_repeat_1	2475	2934	1.35e-52	PROSPERO
low complexity region	3751	3760	N/A	INTRINSIC
low complexity region	3997	4012	N/A	INTRINSIC
low complexity region	4285	4300	N/A	INTRINSIC
Blast:DnaJ	4304	4363	1e-31	BLAST
PDB:1IUR\|A	4309	4376	5e-39	PDB
SCOP:d1gh6a_	4317	4407	2e-3	SMART
HEPN	4454	4570	9.49e-24	SMART

Meta Mutation Damage Score

0.1525

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.4%

Validation Efficiency

99% (83/84)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,921,718	S199T	probably benign	Het
Abca9	T	A	11: 110,139,632	Y763F	probably benign	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Actl11	A	G	9: 107,931,483	T1002A	probably damaging	Het
Ampd1	T	A	3: 103,091,664	N378K	probably damaging	Het
Arhgap42	A	G	9: 9,033,586		probably benign	Het
Arhgap6	C	A	X: 168,796,503	P95T	possibly damaging	Het
Atg14	T	C	14: 47,560,645	N87S	probably benign	Het
Atp9b	C	T	18: 80,762,138	C735Y	probably damaging	Het
Atp9b	T	A	18: 80,778,907	T110S	probably benign	Het
Birc6	T	G	17: 74,612,319	L221R	probably damaging	Het
Ces1c	A	G	8: 93,127,605	F101L	probably benign	Het
Chsy1	T	C	7: 66,172,002	Y662H	probably damaging	Het
Cldn12	A	T	5: 5,507,900	F176I	probably benign	Het
Col5a2	A	G	1: 45,411,466	S374P	probably benign	Het
Col6a2	A	T	10: 76,603,710	V740E	probably damaging	Het
Cpne3	A	T	4: 19,526,336	I401K	probably damaging	Het
Cspp1	T	A	1: 10,088,966		probably null	Het
Ddn	G	A	15: 98,806,766	T215I	possibly damaging	Het
Dync1i1	T	C	6: 5,769,799		probably benign	Het
Dync2li1	T	C	17: 84,647,239		probably benign	Het
Eif2a	T	A	3: 58,537,584	L50*	probably null	Het
Elavl3	G	A	9: 22,018,579	A343V	probably damaging	Het
Fastkd1	T	C	2: 69,708,638		probably null	Het
Fgf8	C	A	19: 45,742,347	V80F	possibly damaging	Het
Fras1	A	T	5: 96,743,187	E2858D	probably benign	Het
Fshr	A	T	17: 88,986,101	L383Q	probably damaging	Het
Glb1	A	G	9: 114,417,103	K74R	probably benign	Het
Gmeb2	T	G	2: 181,255,226	M290L	probably benign	Het
Gnptg	A	G	17: 25,235,854		probably null	Het
Grik2	A	C	10: 49,132,775	S739A	probably damaging	Het
Grk2	T	A	19: 4,287,194	Q659L	probably benign	Het
Hdhd5	A	G	6: 120,514,512	V210A	probably damaging	Het
Hyal1	C	T	9: 107,577,892	L134F	probably damaging	Het
Itgb2	A	T	10: 77,546,153	K18N	possibly damaging	Het
Jam3	A	T	9: 27,106,405	I29K	possibly damaging	Het
Kcnh3	C	A	15: 99,239,915	D830E	probably benign	Het
Kcnmb4	T	C	10: 116,473,298	D75G	possibly damaging	Het
Kdm4b	A	G	17: 56,400,025	Y981C	probably damaging	Het
Klk1b26	C	A	7: 44,016,386	D207E	probably benign	Het
Kmt2a	G	T	9: 44,848,266	T762N	probably benign	Het
Kmt2d	A	G	15: 98,844,938		probably benign	Het
Lama4	T	C	10: 39,088,880	S1414P	possibly damaging	Het
Lce1f	C	G	3: 92,718,969	C127S	unknown	Het
Maats1	A	G	16: 38,321,400	V390A	probably damaging	Het
Map7d1	A	G	4: 126,234,765		probably null	Het
Ninl	T	C	2: 150,980,176	D2G	possibly damaging	Het
Olfr1029	C	T	2: 85,976,028	P262S	possibly damaging	Het
Olfr1369-ps1	T	A	13: 21,116,133	M147K	probably benign	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Olfr195	A	G	16: 59,148,924	T25A	probably benign	Het
Olfr429	T	A	1: 174,089,247	L69*	probably null	Het
Pax8	A	G	2: 24,429,596	Y381H	possibly damaging	Het
Pde7a	T	C	3: 19,260,244	I63V	possibly damaging	Het
Pgm3	A	T	9: 86,570,287	F40Y	probably benign	Het
Phrf1	G	T	7: 141,256,651	D78Y	probably damaging	Het
Plekhg1	C	T	10: 3,940,538		probably benign	Het
Pum1	T	C	4: 130,719,256	S209P	probably damaging	Het
Qtrt2	A	T	16: 43,868,974	F220L	probably benign	Het
Rgs9	A	G	11: 109,268,921		probably null	Het
Rin3	A	G	12: 102,368,759	T230A	unknown	Het
Ros1	A	T	10: 52,098,677	V1604E	possibly damaging	Het
Rpp14	A	G	14: 8,090,528	M151V	probably benign	Het
Scamp1	C	T	13: 94,224,929	V148I	probably benign	Het
Slc13a5	A	G	11: 72,250,731	C428R	probably damaging	Het
Slc43a2	T	G	11: 75,562,907		probably null	Het
Smarcc2	T	A	10: 128,463,872	N135K	probably damaging	Het
Snx15	G	C	19: 6,122,064	S116R	probably damaging	Het
Stag1	A	G	9: 100,855,832	E414G	possibly damaging	Het
Stag1	A	T	9: 100,887,373		probably benign	Het
Tmem106a	T	A	11: 101,590,437	L257Q	possibly damaging	Het
Tnc	C	T	4: 63,964,754	D1968N	probably benign	Het
Trim42	A	G	9: 97,366,085	L186P	possibly damaging	Het
Tshb	T	A	3: 102,778,308		probably benign	Het
Ttn	T	A	2: 76,754,140	D13881V	probably damaging	Het
Uqcrc2	T	C	7: 120,640,283	V56A	probably benign	Het
Uty	G	A	Y: 1,197,228	T113I	probably damaging	Het
Vps13c	A	G	9: 67,957,505	E3032G	probably benign	Het
Wfdc9	T	G	2: 164,651,809		probably benign	Het
Zc3h7a	G	A	16: 11,162,656	T31I	probably damaging	Het
Zfp462	T	C	4: 55,060,046	S1191P	probably damaging	Het

Other mutations in Sacs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Sacs	APN	14	61191635	missense	possibly damaging	0.64
IGL01839:Sacs	APN	14	61183945	intron	probably benign
IGL02024:Sacs	APN	14	61189678	missense	probably damaging	0.96
IGL02247:Sacs	APN	14	61192535	missense	probably damaging	1.00
BB009:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
BB019:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
F6893:Sacs	UTSW	14	61212976	missense	probably benign
IGL03052:Sacs	UTSW	14	61207858	missense	probably damaging	0.99
R0090:Sacs	UTSW	14	61205440	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0390:Sacs	UTSW	14	61205640	missense	possibly damaging	0.92
R0479:Sacs	UTSW	14	61191479	missense	probably damaging	0.99
R0556:Sacs	UTSW	14	61183958	missense	probably damaging	0.99
R0673:Sacs	UTSW	14	61210215	missense	possibly damaging	0.89
R0748:Sacs	UTSW	14	61209265	missense	probably damaging	0.99
R0931:Sacs	UTSW	14	61203495	missense	probably benign
R0972:Sacs	UTSW	14	61211963	nonsense	probably null
R1281:Sacs	UTSW	14	61191801	missense	probably benign	0.02
R1340:Sacs	UTSW	14	61204509	missense	probably damaging	0.98
R1351:Sacs	UTSW	14	61202761	missense	probably benign	0.00
R1538:Sacs	UTSW	14	61210059	missense	probably damaging	0.98
R1581:Sacs	UTSW	14	61213679	missense	probably damaging	0.96
R1599:Sacs	UTSW	14	61203638	missense	probably benign
R1631:Sacs	UTSW	14	61210732	nonsense	probably null
R1635:Sacs	UTSW	14	61203828	missense	probably damaging	0.98
R1655:Sacs	UTSW	14	61191782	missense	probably benign
R1660:Sacs	UTSW	14	61209009	missense	probably damaging	0.99
R1707:Sacs	UTSW	14	61209762	missense	probably benign	0.01
R1733:Sacs	UTSW	14	61205454	missense	probably damaging	1.00
R1772:Sacs	UTSW	14	61210897	missense	probably damaging	1.00
R1976:Sacs	UTSW	14	61202895	missense	probably benign
R2055:Sacs	UTSW	14	61214049	missense	probably damaging	0.97
R2083:Sacs	UTSW	14	61206506	missense	possibly damaging	0.69
R2091:Sacs	UTSW	14	61191919	missense	possibly damaging	0.95
R2105:Sacs	UTSW	14	61173441	missense	possibly damaging	0.90
R2109:Sacs	UTSW	14	61173453	splice site	probably null
R2117:Sacs	UTSW	14	61213771	missense	probably benign	0.01
R2122:Sacs	UTSW	14	61212316	missense	probably damaging	1.00
R2148:Sacs	UTSW	14	61173378	missense	probably damaging	0.97
R2151:Sacs	UTSW	14	61209640	missense	probably damaging	1.00
R2231:Sacs	UTSW	14	61205929	splice site	probably null
R2248:Sacs	UTSW	14	61212802	missense	probably damaging	1.00
R2271:Sacs	UTSW	14	61204660	missense	probably benign	0.06
R2314:Sacs	UTSW	14	61207759	missense	probably benign	0.17
R2436:Sacs	UTSW	14	61202905	missense	possibly damaging	0.94
R2445:Sacs	UTSW	14	61205206	missense	probably damaging	1.00
R2512:Sacs	UTSW	14	61203080	missense	probably benign	0.00
R3434:Sacs	UTSW	14	61212303	missense	probably damaging	1.00
R3785:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3786:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3796:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3798:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3872:Sacs	UTSW	14	61148068	missense	probably benign	0.30
R3873:Sacs	UTSW	14	61192286	missense	possibly damaging	0.64
R3892:Sacs	UTSW	14	61204387	missense	probably damaging	0.98
R4184:Sacs	UTSW	14	61213944	missense	probably damaging	0.97
R4204:Sacs	UTSW	14	61173443	missense	possibly damaging	0.93
R4249:Sacs	UTSW	14	61203457	missense	probably benign	0.02
R4256:Sacs	UTSW	14	61206337	missense	probably damaging	1.00
R4370:Sacs	UTSW	14	61212309	missense	probably damaging	1.00
R4445:Sacs	UTSW	14	61204686	missense	probably benign	0.30
R4503:Sacs	UTSW	14	61207603	missense	probably damaging	1.00
R4548:Sacs	UTSW	14	61191938	missense	probably damaging	1.00
R4582:Sacs	UTSW	14	61191698	missense	probably damaging	1.00
R4613:Sacs	UTSW	14	61211797	splice site	probably null
R4639:Sacs	UTSW	14	61207268	missense	probably benign	0.12
R4697:Sacs	UTSW	14	61212747	missense	probably benign	0.19
R4706:Sacs	UTSW	14	61204273	missense	probably damaging	1.00
R4717:Sacs	UTSW	14	61212855	missense	probably damaging	1.00
R4777:Sacs	UTSW	14	61211809	missense	probably damaging	1.00
R4888:Sacs	UTSW	14	61212198	missense	probably damaging	1.00
R4913:Sacs	UTSW	14	61213797	missense	probably benign	0.17
R4973:Sacs	UTSW	14	61213122	missense	probably damaging	1.00
R4986:Sacs	UTSW	14	61213043	nonsense	probably null
R5090:Sacs	UTSW	14	61205253	missense	probably damaging	1.00
R5243:Sacs	UTSW	14	61205957	nonsense	probably null
R5292:Sacs	UTSW	14	61211983	missense	probably damaging	1.00
R5308:Sacs	UTSW	14	61192400	missense	probably benign	0.21
R5337:Sacs	UTSW	14	61193514	intron	probably benign
R5502:Sacs	UTSW	14	61206100	missense	probably damaging	1.00
R5586:Sacs	UTSW	14	61206441	nonsense	probably null
R5692:Sacs	UTSW	14	61207839	missense	probably benign	0.00
R5725:Sacs	UTSW	14	61211110	missense	probably damaging	1.00
R5854:Sacs	UTSW	14	61211547	missense	probably damaging	1.00
R5959:Sacs	UTSW	14	61212400	missense	probably damaging	0.99
R5960:Sacs	UTSW	14	61208695	missense	probably benign	0.30
R5968:Sacs	UTSW	14	61189629	missense	probably damaging	0.99
R5983:Sacs	UTSW	14	61205199	missense	probably damaging	1.00
R5992:Sacs	UTSW	14	61205543	missense	probably damaging	1.00
R6076:Sacs	UTSW	14	61204536	nonsense	probably null
R6175:Sacs	UTSW	14	61212826	missense	possibly damaging	0.82
R6347:Sacs	UTSW	14	61211160	missense	probably damaging	1.00
R6357:Sacs	UTSW	14	61208824	missense	possibly damaging	0.47
R6415:Sacs	UTSW	14	61205359	missense	probably damaging	1.00
R6469:Sacs	UTSW	14	61191248	missense	probably damaging	1.00
R6503:Sacs	UTSW	14	61211361	missense	probably benign	0.00
R6523:Sacs	UTSW	14	61202961	missense	probably damaging	0.99
R6615:Sacs	UTSW	14	61208934	missense	probably benign	0.15
R6729:Sacs	UTSW	14	61210518	missense	probably damaging	1.00
R6731:Sacs	UTSW	14	61180700	splice site	probably null
R6797:Sacs	UTSW	14	61213073	missense	probably damaging	1.00
R6852:Sacs	UTSW	14	61179288	missense	possibly damaging	0.87
R6922:Sacs	UTSW	14	61211425	missense	probably damaging	1.00
R7023:Sacs	UTSW	14	61208815	missense	probably benign	0.04
R7047:Sacs	UTSW	14	61213002	missense	probably damaging	1.00
R7051:Sacs	UTSW	14	61208928	missense	probably benign	0.25
R7069:Sacs	UTSW	14	61212496	missense	probably damaging	1.00
R7082:Sacs	UTSW	14	61210517	missense	possibly damaging	0.94
R7108:Sacs	UTSW	14	61211009	nonsense	probably null
R7122:Sacs	UTSW	14	61210396	missense	probably damaging	1.00
R7194:Sacs	UTSW	14	61210089	missense	possibly damaging	0.95
R7214:Sacs	UTSW	14	61191792	missense	probably benign
R7221:Sacs	UTSW	14	61208806	missense	probably damaging	0.99
R7274:Sacs	UTSW	14	61214081	missense	possibly damaging	0.88
R7344:Sacs	UTSW	14	61207444	missense	possibly damaging	0.81
R7440:Sacs	UTSW	14	61191605	missense	probably benign	0.10
R7474:Sacs	UTSW	14	61211178	missense	probably benign	0.04
R7512:Sacs	UTSW	14	61204430	missense	probably benign	0.04
R7641:Sacs	UTSW	14	61202871	missense	probably damaging	0.97
R7649:Sacs	UTSW	14	61203228	missense	possibly damaging	0.53
R7703:Sacs	UTSW	14	61206090	missense	possibly damaging	0.81
R7792:Sacs	UTSW	14	61209773	missense	probably benign	0.00
R7805:Sacs	UTSW	14	61203591	missense	not run
R7822:Sacs	UTSW	14	61192203	missense	probably benign	0.03
R7882:Sacs	UTSW	14	61207071	missense	probably benign	0.02
R7932:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
R8031:Sacs	UTSW	14	61204191	missense	probably damaging	0.96
R8064:Sacs	UTSW	14	61192175	missense	possibly damaging	0.92
R8083:Sacs	UTSW	14	61210717	missense	possibly damaging	0.77
R8204:Sacs	UTSW	14	61212948	missense	probably damaging	0.96
R8293:Sacs	UTSW	14	61191099	missense	probably damaging	0.99
R8316:Sacs	UTSW	14	61189619	missense	possibly damaging	0.84
R8393:Sacs	UTSW	14	61173206	start codon destroyed	probably null	0.06
R8434:Sacs	UTSW	14	61213187	nonsense	probably null
R8482:Sacs	UTSW	14	61202955	missense	probably benign
R8497:Sacs	UTSW	14	61192253	missense	probably benign	0.00
R8557:Sacs	UTSW	14	61207276	missense	probably damaging	1.00
X0067:Sacs	UTSW	14	61208019	missense	probably damaging	1.00
Z1176:Sacs	UTSW	14	61210830	nonsense	probably null
Z1176:Sacs	UTSW	14	61213200	missense	probably damaging	1.00
Z1177:Sacs	UTSW	14	61191551	missense	possibly damaging	0.48
Z1177:Sacs	UTSW	14	61207981	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CGCTTGTATTTGAAGTGGCACCCTG -3'
(R):5'- CTTGAAGCACACCCATTCATTGGC -3'

Sequencing Primer
(F):5'- GTGGCACCCTGACAAAAATC -3'
(R):5'- TGAAGGTCATTCCTGGCAGC -3'

Posted On

2014-04-13