Incidental Mutation 'R1495:Ccdc171'
ID 168768
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Name coiled-coil domain containing 171
Synonyms A330015D16Rik, 4930418J05Rik, 4930473A06Rik
MMRRC Submission 039546-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1495 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 83443782-83782907 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 83599332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 724 (K724*)
Ref Sequence ENSEMBL: ENSMUSP00000155912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000231339]
AlphaFold E9Q1U1
Predicted Effect probably null
Transcript: ENSMUST00000053414
AA Change: K716*
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407
AA Change: K716*

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125077
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231339
AA Change: K724*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,614,356 (GRCm39) N488S probably benign Het
Acot10 G A 15: 20,665,593 (GRCm39) R383C probably damaging Het
Acsm2 A G 7: 119,177,349 (GRCm39) D263G probably damaging Het
Adcy2 G T 13: 68,944,654 (GRCm39) Q243K probably benign Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Agt A G 8: 125,286,194 (GRCm39) F296S probably damaging Het
Akap14 T C X: 36,427,618 (GRCm39) D39G possibly damaging Het
Akt3 T C 1: 176,930,608 (GRCm39) M117V probably benign Het
Ankar T C 1: 72,682,450 (GRCm39) T1154A probably benign Het
Arvcf T A 16: 18,207,251 (GRCm39) L70Q probably damaging Het
Ccdc91 A G 6: 147,435,670 (GRCm39) T85A possibly damaging Het
Ccdc9b T G 2: 118,591,013 (GRCm39) K173N probably damaging Het
Cdh3 C T 8: 107,265,629 (GRCm39) T224I probably damaging Het
Clstn3 T C 6: 124,426,876 (GRCm39) I482V probably benign Het
Cnot9 A G 1: 74,562,759 (GRCm39) E176G probably damaging Het
Cntnap4 T G 8: 113,608,395 (GRCm39) L1272V possibly damaging Het
Cyb5a T A 18: 84,869,605 (GRCm39) M1K probably null Het
Cyp2c23 A G 19: 43,993,947 (GRCm39) I473T probably benign Het
Dbil5 T A 11: 76,109,276 (GRCm39) M60K probably benign Het
Defa38 T A 8: 21,585,217 (GRCm39) Q75L probably benign Het
Dgkg A T 16: 22,319,129 (GRCm39) L644Q probably damaging Het
Disp3 T C 4: 148,334,282 (GRCm39) I1004V probably benign Het
Egf T A 3: 129,506,655 (GRCm39) I599F probably damaging Het
Epc2 A G 2: 49,426,675 (GRCm39) T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Extl3 A T 14: 65,313,316 (GRCm39) V622E probably benign Het
Fam227a C T 15: 79,510,446 (GRCm39) V403I probably benign Het
Fat2 T A 11: 55,153,499 (GRCm39) D3571V probably benign Het
Fcho2 A G 13: 98,886,358 (GRCm39) probably null Het
Fras1 A G 5: 96,676,445 (GRCm39) N64S possibly damaging Het
Gabbr1 A G 17: 37,366,832 (GRCm39) N352S possibly damaging Het
Gabra1 T C 11: 42,045,771 (GRCm39) N113S probably damaging Het
Glg1 T C 8: 111,924,307 (GRCm39) Y227C probably damaging Het
Gm5141 A T 13: 62,922,084 (GRCm39) C362S probably damaging Het
Gprc6a T A 10: 51,504,533 (GRCm39) T104S probably benign Het
Jph1 A C 1: 17,161,876 (GRCm39) V262G probably benign Het
Kank1 C G 19: 25,387,713 (GRCm39) T434R probably damaging Het
Kmt2e A G 5: 23,704,325 (GRCm39) S1173G possibly damaging Het
Krt75 G A 15: 101,482,308 (GRCm39) probably benign Het
Lyzl1 G T 18: 4,181,192 (GRCm39) W77L probably null Het
Nipbl T G 15: 8,380,764 (GRCm39) N676T probably benign Het
Obscn C T 11: 58,970,986 (GRCm39) S2300N probably damaging Het
Or9a2 T G 6: 41,748,837 (GRCm39) Y132S probably damaging Het
Osbpl1a T A 18: 12,891,896 (GRCm39) M350L probably benign Het
Pecam1 T C 11: 106,579,682 (GRCm39) D460G probably damaging Het
Pik3c2a T A 7: 115,987,300 (GRCm39) K540N probably benign Het
Prdm12 T A 2: 31,530,205 (GRCm39) I32N probably damaging Het
Prkd1 T C 12: 50,413,135 (GRCm39) S679G probably damaging Het
Psen2 C T 1: 180,056,419 (GRCm39) A393T probably damaging Het
Ptprh T A 7: 4,583,888 (GRCm39) T235S probably benign Het
Ranbp3 C T 17: 57,012,527 (GRCm39) P182L probably benign Het
Serpinb7 A T 1: 107,379,390 (GRCm39) K266* probably null Het
Sesn3 T C 9: 14,219,817 (GRCm39) S69P probably damaging Het
Slc12a6 T C 2: 112,184,535 (GRCm39) M818T probably damaging Het
Slc25a53 C A X: 135,916,084 (GRCm39) C4F unknown Het
Snx1 T A 9: 66,003,879 (GRCm39) L255F probably benign Het
Sptbn2 T G 19: 4,769,004 (GRCm39) S46A possibly damaging Het
Taf4 A G 2: 179,574,820 (GRCm39) F595S probably damaging Het
Tec A T 5: 72,944,098 (GRCm39) V103E probably damaging Het
Tmco5b T C 2: 113,121,136 (GRCm39) S147P possibly damaging Het
Uchl5 C T 1: 143,675,675 (GRCm39) T93I possibly damaging Het
Usp14 A T 18: 10,004,994 (GRCm39) S225T probably benign Het
Usp45 C A 4: 21,797,385 (GRCm39) Q238K possibly damaging Het
Vmn1r6 T A 6: 56,980,058 (GRCm39) M218K possibly damaging Het
Zfp84 T A 7: 29,476,728 (GRCm39) Y473* probably null Het
Zyg11b G A 4: 108,123,410 (GRCm39) P186S probably damaging Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83,600,561 (GRCm39) nonsense probably null
IGL00707:Ccdc171 APN 4 83,599,392 (GRCm39) missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83,782,486 (GRCm39) missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83,580,047 (GRCm39) missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83,599,432 (GRCm39) missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83,573,815 (GRCm39) missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83,713,479 (GRCm39) missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83,661,255 (GRCm39) missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83,713,545 (GRCm39) missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83,736,327 (GRCm39) missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83,599,615 (GRCm39) missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83,581,754 (GRCm39) missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83,579,946 (GRCm39)
PIT4445001:Ccdc171 UTSW 4 83,579,984 (GRCm39) missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83,614,678 (GRCm39) splice site probably benign
R0284:Ccdc171 UTSW 4 83,467,975 (GRCm39) missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83,553,919 (GRCm39) missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83,599,481 (GRCm39) missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83,580,095 (GRCm39) missense possibly damaging 0.90
R1741:Ccdc171 UTSW 4 83,539,076 (GRCm39) missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83,599,521 (GRCm39) missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83,473,045 (GRCm39) missense probably damaging 0.99
R1801:Ccdc171 UTSW 4 83,465,132 (GRCm39) missense probably benign 0.41
R4204:Ccdc171 UTSW 4 83,599,392 (GRCm39) missense probably benign 0.11
R4245:Ccdc171 UTSW 4 83,473,045 (GRCm39) missense probably damaging 0.99
R4502:Ccdc171 UTSW 4 83,782,560 (GRCm39) missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83,782,560 (GRCm39) missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83,575,579 (GRCm39) missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83,467,855 (GRCm39) missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83,599,253 (GRCm39) missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83,713,458 (GRCm39) missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83,612,569 (GRCm39) missense probably damaging 1.00
R4926:Ccdc171 UTSW 4 83,476,829 (GRCm39) intron probably benign
R4937:Ccdc171 UTSW 4 83,467,876 (GRCm39) missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83,476,763 (GRCm39) intron probably benign
R5185:Ccdc171 UTSW 4 83,581,892 (GRCm39) missense possibly damaging 0.84
R5210:Ccdc171 UTSW 4 83,473,093 (GRCm39) missense probably damaging 1.00
R5243:Ccdc171 UTSW 4 83,522,344 (GRCm39) missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83,612,199 (GRCm39) missense probably benign 0.00
R5574:Ccdc171 UTSW 4 83,611,990 (GRCm39) missense probably damaging 1.00
R6053:Ccdc171 UTSW 4 83,713,456 (GRCm39) missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83,473,087 (GRCm39) missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83,614,554 (GRCm39) nonsense probably null
R6339:Ccdc171 UTSW 4 83,661,234 (GRCm39) missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83,782,527 (GRCm39) missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83,611,998 (GRCm39) missense probably benign 0.00
R7352:Ccdc171 UTSW 4 83,736,260 (GRCm39) missense possibly damaging 0.82
R7390:Ccdc171 UTSW 4 83,736,304 (GRCm39) missense probably damaging 1.00
R7626:Ccdc171 UTSW 4 83,499,012 (GRCm39) nonsense probably null
R7686:Ccdc171 UTSW 4 83,575,556 (GRCm39) missense unknown
R7705:Ccdc171 UTSW 4 83,476,193 (GRCm39) missense possibly damaging 0.87
R7934:Ccdc171 UTSW 4 83,614,492 (GRCm39) nonsense probably null
R8058:Ccdc171 UTSW 4 83,499,003 (GRCm39) missense probably damaging 0.99
R8114:Ccdc171 UTSW 4 83,614,537 (GRCm39) missense probably damaging 1.00
R8253:Ccdc171 UTSW 4 83,661,207 (GRCm39) missense probably damaging 0.99
R8257:Ccdc171 UTSW 4 83,614,606 (GRCm39) missense probably damaging 1.00
R8378:Ccdc171 UTSW 4 83,782,490 (GRCm39) missense possibly damaging 0.67
R8501:Ccdc171 UTSW 4 83,581,895 (GRCm39) nonsense probably null
R8517:Ccdc171 UTSW 4 83,661,298 (GRCm39) missense probably damaging 1.00
R8697:Ccdc171 UTSW 4 83,600,577 (GRCm39) missense probably damaging 1.00
R9149:Ccdc171 UTSW 4 83,612,512 (GRCm39) missense probably damaging 1.00
R9430:Ccdc171 UTSW 4 83,522,362 (GRCm39) missense probably damaging 1.00
R9642:Ccdc171 UTSW 4 83,599,525 (GRCm39) missense probably benign 0.12
R9686:Ccdc171 UTSW 4 83,467,919 (GRCm39) missense probably damaging 1.00
U24488:Ccdc171 UTSW 4 83,579,954 (GRCm39) missense probably damaging 1.00
Z1176:Ccdc171 UTSW 4 83,713,467 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAAACCTGTCAGGCCCACTG -3'
(R):5'- GAGTCTGTTTGCTGCCAAGATTGC -3'

Sequencing Primer
(F):5'- GCCCACTGTGTGCACTTAGATA -3'
(R):5'- GACACGGACCAATCCTTTGAATG -3'
Posted On 2014-04-13