Mutagenetix > Incidental Mutation

Incidental Mutation 'R1495:Clstn3'

168779

Institutional Source

Beutler Lab

Gene Symbol

Clstn3

Ensembl Gene

ENSMUSG00000008153

Gene Name

calsyntenin 3

Synonyms

alcadein-beta, Cst-3, CSTN3

MMRRC Submission

039546-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124430759-124464794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124449917 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 482 (I482V)

Ref Sequence

ENSEMBL: ENSMUSP00000108142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]

AlphaFold

Q99JH7

Predicted Effect

probably benign
Transcript: ENSMUST00000008297
AA Change: I519V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: I519V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CA	50	143	2.72e-12	SMART
CA	166	244	4.04e-2	SMART
SCOP:d1a8d_1	333	549	7e-23	SMART
transmembrane domain	846	868	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112523
AA Change: I482V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: I482V

Domain	Start	End	E-Value	Type
CA	13	106	2.72e-12	SMART
CA	129	207	4.04e-2	SMART
Pfam:Laminin_G_3	304	505	4.1e-8	PFAM
transmembrane domain	809	831	N/A	INTRINSIC
low complexity region	891	908	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147947

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,477,820	N488S	probably benign	Het
A430105I19Rik	T	G	2: 118,760,532	K173N	probably damaging	Het
Acot10	G	A	15: 20,665,507	R383C	probably damaging	Het
Acsm2	A	G	7: 119,578,126	D263G	probably damaging	Het
Adcy2	G	T	13: 68,796,535	Q243K	probably benign	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Agt	A	G	8: 124,559,455	F296S	probably damaging	Het
Akap14	T	C	X: 37,163,965	D39G	possibly damaging	Het
Akt3	T	C	1: 177,103,042	M117V	probably benign	Het
Ankar	T	C	1: 72,643,291	T1154A	probably benign	Het
Arvcf	T	A	16: 18,389,386	L70Q	probably damaging	Het
Ccdc171	A	T	4: 83,681,095	K724*	probably null	Het
Ccdc91	A	G	6: 147,534,172	T85A	possibly damaging	Het
Cdh3	C	T	8: 106,538,997	T224I	probably damaging	Het
Cnot9	A	G	1: 74,523,600	E176G	probably damaging	Het
Cntnap4	T	G	8: 112,881,763	L1272V	possibly damaging	Het
Cyb5a	T	A	18: 84,851,480	M1K	probably null	Het
Cyp2c23	A	G	19: 44,005,508	I473T	probably benign	Het
Dbil5	T	A	11: 76,218,450	M60K	probably benign	Het
Dgkg	A	T	16: 22,500,379	L644Q	probably damaging	Het
Disp3	T	C	4: 148,249,825	I1004V	probably benign	Het
Egf	T	A	3: 129,713,006	I599F	probably damaging	Het
Epc2	A	G	2: 49,536,663	T145A	probably damaging	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Extl3	A	T	14: 65,075,867	V622E	probably benign	Het
Fam227a	C	T	15: 79,626,245	V403I	probably benign	Het
Fat2	T	A	11: 55,262,673	D3571V	probably benign	Het
Fcho2	A	G	13: 98,749,850		probably null	Het
Fras1	A	G	5: 96,528,586	N64S	possibly damaging	Het
Gabbr1	A	G	17: 37,055,940	N352S	possibly damaging	Het
Gabra1	T	C	11: 42,154,944	N113S	probably damaging	Het
Glg1	T	C	8: 111,197,675	Y227C	probably damaging	Het
Gm14851	T	A	8: 21,095,201	Q75L	probably benign	Het
Gm5141	A	T	13: 62,774,270	C362S	probably damaging	Het
Gprc6a	T	A	10: 51,628,437	T104S	probably benign	Het
Jph1	A	C	1: 17,091,652	V262G	probably benign	Het
Kank1	C	G	19: 25,410,349	T434R	probably damaging	Het
Kmt2e	A	G	5: 23,499,327	S1173G	possibly damaging	Het
Krt75	G	A	15: 101,573,873		probably benign	Het
Lyzl1	G	T	18: 4,181,192	W77L	probably null	Het
Nipbl	T	G	15: 8,351,280	N676T	probably benign	Het
Obscn	C	T	11: 59,080,160	S2300N	probably damaging	Het
Olfr459	T	G	6: 41,771,903	Y132S	probably damaging	Het
Osbpl1a	T	A	18: 12,758,839	M350L	probably benign	Het
Pecam1	T	C	11: 106,688,856	D460G	probably damaging	Het
Pik3c2a	T	A	7: 116,388,065	K540N	probably benign	Het
Prdm12	T	A	2: 31,640,193	I32N	probably damaging	Het
Prkd1	T	C	12: 50,366,352	S679G	probably damaging	Het
Psen2	C	T	1: 180,228,854	A393T	probably damaging	Het
Ptprh	T	A	7: 4,580,889	T235S	probably benign	Het
Ranbp3	C	T	17: 56,705,527	P182L	probably benign	Het
Serpinb7	A	T	1: 107,451,660	K266*	probably null	Het
Sesn3	T	C	9: 14,308,521	S69P	probably damaging	Het
Slc12a6	T	C	2: 112,354,190	M818T	probably damaging	Het
Slc25a53	C	A	X: 137,015,335	C4F	unknown	Het
Snx1	T	A	9: 66,096,597	L255F	probably benign	Het
Sptbn2	T	G	19: 4,718,976	S46A	possibly damaging	Het
Taf4	A	G	2: 179,933,027	F595S	probably damaging	Het
Tec	A	T	5: 72,786,755	V103E	probably damaging	Het
Tmco5b	T	C	2: 113,290,791	S147P	possibly damaging	Het
Uchl5	C	T	1: 143,799,937	T93I	possibly damaging	Het
Usp14	A	T	18: 10,004,994	S225T	probably benign	Het
Usp45	C	A	4: 21,797,385	Q238K	possibly damaging	Het
Vmn1r6	T	A	6: 57,003,073	M218K	possibly damaging	Het
Zfp84	T	A	7: 29,777,303	Y473*	probably null	Het
Zyg11b	G	A	4: 108,266,213	P186S	probably damaging	Het

Other mutations in Clstn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Clstn3	APN	6	124462139	missense	probably damaging	1.00
IGL01415:Clstn3	APN	6	124438822	nonsense	probably null
IGL01521:Clstn3	APN	6	124458031	nonsense	probably null
IGL01537:Clstn3	APN	6	124431600	missense	possibly damaging	0.91
IGL01729:Clstn3	APN	6	124449794	missense	probably benign	0.06
IGL01879:Clstn3	APN	6	124438810	missense	probably damaging	1.00
IGL01998:Clstn3	APN	6	124458663	missense	probably damaging	1.00
IGL03130:Clstn3	APN	6	124459263	missense	probably damaging	0.98
IGL03405:Clstn3	APN	6	124438368	missense	possibly damaging	0.95
PIT4403001:Clstn3	UTSW	6	124458023	missense	probably damaging	1.00
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0208:Clstn3	UTSW	6	124432169	splice site	probably benign
R0276:Clstn3	UTSW	6	124431740	splice site	probably benign
R0440:Clstn3	UTSW	6	124451413	missense	probably damaging	1.00
R0612:Clstn3	UTSW	6	124449500	missense	probably damaging	0.98
R1200:Clstn3	UTSW	6	124459170	missense	probably damaging	1.00
R1224:Clstn3	UTSW	6	124457919	missense	probably benign
R1378:Clstn3	UTSW	6	124438419	missense	probably damaging	1.00
R1491:Clstn3	UTSW	6	124437490	missense	possibly damaging	0.51
R1511:Clstn3	UTSW	6	124462169	missense	probably damaging	1.00
R1655:Clstn3	UTSW	6	124437427	missense	probably damaging	1.00
R1731:Clstn3	UTSW	6	124431632	missense	probably benign	0.04
R1734:Clstn3	UTSW	6	124436814	splice site	probably benign
R1751:Clstn3	UTSW	6	124431999	missense	probably damaging	1.00
R1954:Clstn3	UTSW	6	124459298	missense	possibly damaging	0.94
R2133:Clstn3	UTSW	6	124449503	missense	probably benign
R2192:Clstn3	UTSW	6	124459207	missense	probably damaging	1.00
R2314:Clstn3	UTSW	6	124450717	missense	probably benign	0.39
R2874:Clstn3	UTSW	6	124438335	missense	probably damaging	1.00
R3500:Clstn3	UTSW	6	124431711	missense	probably benign	0.01
R3761:Clstn3	UTSW	6	124457876	missense	possibly damaging	0.54
R3878:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3927:Clstn3	UTSW	6	124451368	missense	probably damaging	1.00
R3934:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3935:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R4063:Clstn3	UTSW	6	124449833	missense	possibly damaging	0.51
R4402:Clstn3	UTSW	6	124456980	missense	probably damaging	0.96
R4534:Clstn3	UTSW	6	124459220	missense	probably damaging	1.00
R4785:Clstn3	UTSW	6	124437372	splice site	probably null
R4834:Clstn3	UTSW	6	124431953	splice site	probably null
R5921:Clstn3	UTSW	6	124431580	utr 3 prime	probably benign
R5932:Clstn3	UTSW	6	124438332	missense	probably benign	0.01
R6025:Clstn3	UTSW	6	124431664	missense	possibly damaging	0.73
R6101:Clstn3	UTSW	6	124461670	missense	probably damaging	1.00
R6360:Clstn3	UTSW	6	124438429	missense	possibly damaging	0.88
R6578:Clstn3	UTSW	6	124450704	critical splice donor site	probably null
R6813:Clstn3	UTSW	6	124436935	missense	probably benign	0.00
R7380:Clstn3	UTSW	6	124456989	missense	probably benign	0.01
R7419:Clstn3	UTSW	6	124458129	missense	probably benign	0.05
R7625:Clstn3	UTSW	6	124437418	nonsense	probably null
R7780:Clstn3	UTSW	6	124462202	missense	probably damaging	0.98
R7936:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R7939:Clstn3	UTSW	6	124462199	missense	probably damaging	1.00
R8047:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R8079:Clstn3	UTSW	6	124459804	missense	probably damaging	1.00
R8085:Clstn3	UTSW	6	124458724	missense	probably benign	0.23
R8299:Clstn3	UTSW	6	124437373	critical splice donor site	probably null
R8406:Clstn3	UTSW	6	124462177	missense	probably damaging	1.00
R8685:Clstn3	UTSW	6	124456908	missense	probably damaging	1.00
R9045:Clstn3	UTSW	6	124431962	missense	probably damaging	0.98
R9209:Clstn3	UTSW	6	124431612	missense	probably benign	0.02
R9264:Clstn3	UTSW	6	124459768	missense	probably damaging	1.00
R9268:Clstn3	UTSW	6	124456921	missense	probably damaging	0.99
R9443:Clstn3	UTSW	6	124451399	missense	probably damaging	1.00
RF014:Clstn3	UTSW	6	124459266	nonsense	probably null
X0066:Clstn3	UTSW	6	124449811	missense	probably benign	0.13
Z1176:Clstn3	UTSW	6	124459200	missense	probably damaging	1.00
Z1177:Clstn3	UTSW	6	124449781	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGTTGAAGGTCTCCACATCATCCCC -3'
(R):5'- TGGAAAGACGCCCTCTCTTACAGTCC -3'

Sequencing Primer
(F):5'- TGGGTCCCAGACACAGAC -3'
(R):5'- cctcctcctctctctcctc -3'

Posted On

2014-04-13