Mutagenetix > Incidental Mutation

Incidental Mutation 'R1495:Ptprh'

168781

Institutional Source

Beutler Lab

Gene Symbol

Ptprh

Ensembl Gene

ENSMUSG00000035429

Gene Name

protein tyrosine phosphatase, receptor type, H

Synonyms

SAP-1

MMRRC Submission

039546-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4548612-4604041 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4580889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 235 (T235S)

Ref Sequence

ENSEMBL: ENSMUSP00000145543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]

AlphaFold

E9Q0N2

Predicted Effect

probably benign
Transcript: ENSMUST00000049113
AA Change: T235S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: T235S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000103950

Predicted Effect

probably benign
Transcript: ENSMUST00000166650
AA Change: T235S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: T235S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206999
AA Change: T235S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,477,820	N488S	probably benign	Het
A430105I19Rik	T	G	2: 118,760,532	K173N	probably damaging	Het
Acot10	G	A	15: 20,665,507	R383C	probably damaging	Het
Acsm2	A	G	7: 119,578,126	D263G	probably damaging	Het
Adcy2	G	T	13: 68,796,535	Q243K	probably benign	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Agt	A	G	8: 124,559,455	F296S	probably damaging	Het
Akap14	T	C	X: 37,163,965	D39G	possibly damaging	Het
Akt3	T	C	1: 177,103,042	M117V	probably benign	Het
Ankar	T	C	1: 72,643,291	T1154A	probably benign	Het
Arvcf	T	A	16: 18,389,386	L70Q	probably damaging	Het
Ccdc171	A	T	4: 83,681,095	K724*	probably null	Het
Ccdc91	A	G	6: 147,534,172	T85A	possibly damaging	Het
Cdh3	C	T	8: 106,538,997	T224I	probably damaging	Het
Clstn3	T	C	6: 124,449,917	I482V	probably benign	Het
Cnot9	A	G	1: 74,523,600	E176G	probably damaging	Het
Cntnap4	T	G	8: 112,881,763	L1272V	possibly damaging	Het
Cyb5a	T	A	18: 84,851,480	M1K	probably null	Het
Cyp2c23	A	G	19: 44,005,508	I473T	probably benign	Het
Dbil5	T	A	11: 76,218,450	M60K	probably benign	Het
Dgkg	A	T	16: 22,500,379	L644Q	probably damaging	Het
Disp3	T	C	4: 148,249,825	I1004V	probably benign	Het
Egf	T	A	3: 129,713,006	I599F	probably damaging	Het
Epc2	A	G	2: 49,536,663	T145A	probably damaging	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Extl3	A	T	14: 65,075,867	V622E	probably benign	Het
Fam227a	C	T	15: 79,626,245	V403I	probably benign	Het
Fat2	T	A	11: 55,262,673	D3571V	probably benign	Het
Fcho2	A	G	13: 98,749,850		probably null	Het
Fras1	A	G	5: 96,528,586	N64S	possibly damaging	Het
Gabbr1	A	G	17: 37,055,940	N352S	possibly damaging	Het
Gabra1	T	C	11: 42,154,944	N113S	probably damaging	Het
Glg1	T	C	8: 111,197,675	Y227C	probably damaging	Het
Gm14851	T	A	8: 21,095,201	Q75L	probably benign	Het
Gm5141	A	T	13: 62,774,270	C362S	probably damaging	Het
Gprc6a	T	A	10: 51,628,437	T104S	probably benign	Het
Jph1	A	C	1: 17,091,652	V262G	probably benign	Het
Kank1	C	G	19: 25,410,349	T434R	probably damaging	Het
Kmt2e	A	G	5: 23,499,327	S1173G	possibly damaging	Het
Krt75	G	A	15: 101,573,873		probably benign	Het
Lyzl1	G	T	18: 4,181,192	W77L	probably null	Het
Nipbl	T	G	15: 8,351,280	N676T	probably benign	Het
Obscn	C	T	11: 59,080,160	S2300N	probably damaging	Het
Olfr459	T	G	6: 41,771,903	Y132S	probably damaging	Het
Osbpl1a	T	A	18: 12,758,839	M350L	probably benign	Het
Pecam1	T	C	11: 106,688,856	D460G	probably damaging	Het
Pik3c2a	T	A	7: 116,388,065	K540N	probably benign	Het
Prdm12	T	A	2: 31,640,193	I32N	probably damaging	Het
Prkd1	T	C	12: 50,366,352	S679G	probably damaging	Het
Psen2	C	T	1: 180,228,854	A393T	probably damaging	Het
Ranbp3	C	T	17: 56,705,527	P182L	probably benign	Het
Serpinb7	A	T	1: 107,451,660	K266*	probably null	Het
Sesn3	T	C	9: 14,308,521	S69P	probably damaging	Het
Slc12a6	T	C	2: 112,354,190	M818T	probably damaging	Het
Slc25a53	C	A	X: 137,015,335	C4F	unknown	Het
Snx1	T	A	9: 66,096,597	L255F	probably benign	Het
Sptbn2	T	G	19: 4,718,976	S46A	possibly damaging	Het
Taf4	A	G	2: 179,933,027	F595S	probably damaging	Het
Tec	A	T	5: 72,786,755	V103E	probably damaging	Het
Tmco5b	T	C	2: 113,290,791	S147P	possibly damaging	Het
Uchl5	C	T	1: 143,799,937	T93I	possibly damaging	Het
Usp14	A	T	18: 10,004,994	S225T	probably benign	Het
Usp45	C	A	4: 21,797,385	Q238K	possibly damaging	Het
Vmn1r6	T	A	6: 57,003,073	M218K	possibly damaging	Het
Zfp84	T	A	7: 29,777,303	Y473*	probably null	Het
Zyg11b	G	A	4: 108,266,213	P186S	probably damaging	Het

Other mutations in Ptprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01766:Ptprh	APN	7	4580916	missense	probably benign	0.23
IGL02420:Ptprh	APN	7	4580930	missense	probably damaging	1.00
IGL02619:Ptprh	APN	7	4549499	missense	probably damaging	1.00
IGL02729:Ptprh	APN	7	4580874	missense	probably damaging	0.99
BB008:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
BB018:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
R0018:Ptprh	UTSW	7	4601846	critical splice donor site	probably null
R0049:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R0449:Ptprh	UTSW	7	4598006	missense	probably damaging	1.00
R0477:Ptprh	UTSW	7	4597998	missense	possibly damaging	0.87
R0626:Ptprh	UTSW	7	4564272	missense	probably benign	0.00
R0741:Ptprh	UTSW	7	4554173	critical splice donor site	probably null
R1068:Ptprh	UTSW	7	4549463	missense	possibly damaging	0.89
R1226:Ptprh	UTSW	7	4603092	nonsense	probably null
R1487:Ptprh	UTSW	7	4552738	missense	probably damaging	1.00
R1537:Ptprh	UTSW	7	4549699	missense	probably damaging	1.00
R1601:Ptprh	UTSW	7	4552638	missense	probably damaging	1.00
R1731:Ptprh	UTSW	7	4601913	missense	probably benign	0.00
R1920:Ptprh	UTSW	7	4549395	missense	probably benign	0.25
R2082:Ptprh	UTSW	7	4550775	missense	probably damaging	1.00
R2180:Ptprh	UTSW	7	4601868	missense	probably benign	0.26
R2214:Ptprh	UTSW	7	4552922	missense	possibly damaging	0.78
R2245:Ptprh	UTSW	7	4573346	missense	probably benign	0.09
R2271:Ptprh	UTSW	7	4603133	start gained	probably benign
R3693:Ptprh	UTSW	7	4554235	missense	probably damaging	0.99
R3713:Ptprh	UTSW	7	4571970	missense	probably damaging	1.00
R4081:Ptprh	UTSW	7	4580988	missense	probably damaging	0.99
R4205:Ptprh	UTSW	7	4597992	missense	probably damaging	1.00
R4689:Ptprh	UTSW	7	4597997	missense	possibly damaging	0.74
R4782:Ptprh	UTSW	7	4569577	missense	probably benign	0.08
R4838:Ptprh	UTSW	7	4573430	missense	possibly damaging	0.78
R4974:Ptprh	UTSW	7	4551007	splice site	probably null
R5218:Ptprh	UTSW	7	4597920	missense	probably benign	0.05
R5430:Ptprh	UTSW	7	4551047	missense	probably damaging	1.00
R5533:Ptprh	UTSW	7	4549505	missense	probably damaging	1.00
R5544:Ptprh	UTSW	7	4580910	nonsense	probably null
R5547:Ptprh	UTSW	7	4554222	nonsense	probably null
R5869:Ptprh	UTSW	7	4601940	missense	probably benign	0.00
R5928:Ptprh	UTSW	7	4573508	missense	probably damaging	1.00
R6063:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R6112:Ptprh	UTSW	7	4597923	missense	probably benign	0.01
R6493:Ptprh	UTSW	7	4580990	missense	possibly damaging	0.65
R6733:Ptprh	UTSW	7	4603044	splice site	probably null
R6836:Ptprh	UTSW	7	4551135	missense	probably damaging	1.00
R6859:Ptprh	UTSW	7	4549371	nonsense	probably null
R6868:Ptprh	UTSW	7	4601865	missense	probably benign
R7015:Ptprh	UTSW	7	4552627	critical splice donor site	probably null
R7092:Ptprh	UTSW	7	4580861	critical splice donor site	probably null
R7147:Ptprh	UTSW	7	4550782	missense	probably damaging	1.00
R7177:Ptprh	UTSW	7	4569481	missense	possibly damaging	0.77
R7358:Ptprh	UTSW	7	4551007	splice site	probably null
R7436:Ptprh	UTSW	7	4552743	missense	probably damaging	1.00
R7512:Ptprh	UTSW	7	4571781	missense	possibly damaging	0.60
R7863:Ptprh	UTSW	7	4603098	start codon destroyed	probably benign	0.31
R7931:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
R7973:Ptprh	UTSW	7	4580888	missense	possibly damaging	0.55
R8239:Ptprh	UTSW	7	4581091	missense	probably damaging	1.00
R8331:Ptprh	UTSW	7	4549481	missense	probably damaging	1.00
R8688:Ptprh	UTSW	7	4551023	missense	probably benign	0.03
R8700:Ptprh	UTSW	7	4564191	missense	probably damaging	1.00
R8716:Ptprh	UTSW	7	4564274	missense	probably damaging	1.00
R8970:Ptprh	UTSW	7	4580945	missense	possibly damaging	0.84
R9119:Ptprh	UTSW	7	4552713	missense	probably benign	0.25
R9203:Ptprh	UTSW	7	4571971	missense	probably damaging	1.00
R9213:Ptprh	UTSW	7	4580912	missense	probably damaging	0.99
R9250:Ptprh	UTSW	7	4573290	missense	probably benign	0.03
RF022:Ptprh	UTSW	7	4549368	missense	probably benign
Z1177:Ptprh	UTSW	7	4597971	missense	probably damaging	0.99
Z1177:Ptprh	UTSW	7	4598118	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTAGCACTGGCATGAGTAGTATGG -3'
(R):5'- AGGACCAGGAACAACGCTGATTTC -3'

Sequencing Primer
(F):5'- TGAGTAGTATGGGCTACATACTCAG -3'
(R):5'- TTTCAGCTCCAAACCCAGTGAG -3'

Posted On

2014-04-13