Incidental Mutation 'R1495:Ptprh'
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
MMRRC Submission 039546-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1495 (G1)
Quality Score225
Status Not validated
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4580889 bp
Amino Acid Change Threonine to Serine at position 235 (T235S)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect probably benign
Transcript: ENSMUST00000049113
AA Change: T235S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: T235S

signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103950
Predicted Effect probably benign
Transcript: ENSMUST00000166650
AA Change: T235S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: T235S

signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206999
AA Change: T235S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,477,820 N488S probably benign Het
A430105I19Rik T G 2: 118,760,532 K173N probably damaging Het
Acot10 G A 15: 20,665,507 R383C probably damaging Het
Acsm2 A G 7: 119,578,126 D263G probably damaging Het
Adcy2 G T 13: 68,796,535 Q243K probably benign Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Agt A G 8: 124,559,455 F296S probably damaging Het
Akap14 T C X: 37,163,965 D39G possibly damaging Het
Akt3 T C 1: 177,103,042 M117V probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Arvcf T A 16: 18,389,386 L70Q probably damaging Het
Ccdc171 A T 4: 83,681,095 K724* probably null Het
Ccdc91 A G 6: 147,534,172 T85A possibly damaging Het
Cdh3 C T 8: 106,538,997 T224I probably damaging Het
Clstn3 T C 6: 124,449,917 I482V probably benign Het
Cnot9 A G 1: 74,523,600 E176G probably damaging Het
Cntnap4 T G 8: 112,881,763 L1272V possibly damaging Het
Cyb5a T A 18: 84,851,480 M1K probably null Het
Cyp2c23 A G 19: 44,005,508 I473T probably benign Het
Dbil5 T A 11: 76,218,450 M60K probably benign Het
Dgkg A T 16: 22,500,379 L644Q probably damaging Het
Disp3 T C 4: 148,249,825 I1004V probably benign Het
Egf T A 3: 129,713,006 I599F probably damaging Het
Epc2 A G 2: 49,536,663 T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Extl3 A T 14: 65,075,867 V622E probably benign Het
Fam227a C T 15: 79,626,245 V403I probably benign Het
Fat2 T A 11: 55,262,673 D3571V probably benign Het
Fcho2 A G 13: 98,749,850 probably null Het
Fras1 A G 5: 96,528,586 N64S possibly damaging Het
Gabbr1 A G 17: 37,055,940 N352S possibly damaging Het
Gabra1 T C 11: 42,154,944 N113S probably damaging Het
Glg1 T C 8: 111,197,675 Y227C probably damaging Het
Gm14851 T A 8: 21,095,201 Q75L probably benign Het
Gm5141 A T 13: 62,774,270 C362S probably damaging Het
Gprc6a T A 10: 51,628,437 T104S probably benign Het
Jph1 A C 1: 17,091,652 V262G probably benign Het
Kank1 C G 19: 25,410,349 T434R probably damaging Het
Kmt2e A G 5: 23,499,327 S1173G possibly damaging Het
Krt75 G A 15: 101,573,873 probably benign Het
Lyzl1 G T 18: 4,181,192 W77L probably null Het
Nipbl T G 15: 8,351,280 N676T probably benign Het
Obscn C T 11: 59,080,160 S2300N probably damaging Het
Olfr459 T G 6: 41,771,903 Y132S probably damaging Het
Osbpl1a T A 18: 12,758,839 M350L probably benign Het
Pecam1 T C 11: 106,688,856 D460G probably damaging Het
Pik3c2a T A 7: 116,388,065 K540N probably benign Het
Prdm12 T A 2: 31,640,193 I32N probably damaging Het
Prkd1 T C 12: 50,366,352 S679G probably damaging Het
Psen2 C T 1: 180,228,854 A393T probably damaging Het
Ranbp3 C T 17: 56,705,527 P182L probably benign Het
Serpinb7 A T 1: 107,451,660 K266* probably null Het
Sesn3 T C 9: 14,308,521 S69P probably damaging Het
Slc12a6 T C 2: 112,354,190 M818T probably damaging Het
Slc25a53 C A X: 137,015,335 C4F unknown Het
Snx1 T A 9: 66,096,597 L255F probably benign Het
Sptbn2 T G 19: 4,718,976 S46A possibly damaging Het
Taf4 A G 2: 179,933,027 F595S probably damaging Het
Tec A T 5: 72,786,755 V103E probably damaging Het
Tmco5b T C 2: 113,290,791 S147P possibly damaging Het
Uchl5 C T 1: 143,799,937 T93I possibly damaging Het
Usp14 A T 18: 10,004,994 S225T probably benign Het
Usp45 C A 4: 21,797,385 Q238K possibly damaging Het
Vmn1r6 T A 6: 57,003,073 M218K possibly damaging Het
Zfp84 T A 7: 29,777,303 Y473* probably null Het
Zyg11b G A 4: 108,266,213 P186S probably damaging Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
BB008:Ptprh UTSW 7 4571988 missense probably benign 0.03
BB018:Ptprh UTSW 7 4571988 missense probably benign 0.03
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
R7863:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
R7931:Ptprh UTSW 7 4571988 missense probably benign 0.03
R7973:Ptprh UTSW 7 4580888 missense possibly damaging 0.55
R8239:Ptprh UTSW 7 4581091 missense probably damaging 1.00
R8331:Ptprh UTSW 7 4549481 missense probably damaging 1.00
RF022:Ptprh UTSW 7 4549368 missense probably benign
Z1177:Ptprh UTSW 7 4597971 missense probably damaging 0.99
Z1177:Ptprh UTSW 7 4598118 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-04-13