Mutagenetix > Incidental Mutation

Incidental Mutation 'R1495:Pik3c2a'

168783

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

039546-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116388065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 540 (K540N)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000170430
AA Change: K540N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: K540N

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205378

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205767

Predicted Effect

probably benign
Transcript: ENSMUST00000206219
AA Change: K540N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,477,820	N488S	probably benign	Het
A430105I19Rik	T	G	2: 118,760,532	K173N	probably damaging	Het
Acot10	G	A	15: 20,665,507	R383C	probably damaging	Het
Acsm2	A	G	7: 119,578,126	D263G	probably damaging	Het
Adcy2	G	T	13: 68,796,535	Q243K	probably benign	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Agt	A	G	8: 124,559,455	F296S	probably damaging	Het
Akap14	T	C	X: 37,163,965	D39G	possibly damaging	Het
Akt3	T	C	1: 177,103,042	M117V	probably benign	Het
Ankar	T	C	1: 72,643,291	T1154A	probably benign	Het
Arvcf	T	A	16: 18,389,386	L70Q	probably damaging	Het
Ccdc171	A	T	4: 83,681,095	K724*	probably null	Het
Ccdc91	A	G	6: 147,534,172	T85A	possibly damaging	Het
Cdh3	C	T	8: 106,538,997	T224I	probably damaging	Het
Clstn3	T	C	6: 124,449,917	I482V	probably benign	Het
Cnot9	A	G	1: 74,523,600	E176G	probably damaging	Het
Cntnap4	T	G	8: 112,881,763	L1272V	possibly damaging	Het
Cyb5a	T	A	18: 84,851,480	M1K	probably null	Het
Cyp2c23	A	G	19: 44,005,508	I473T	probably benign	Het
Dbil5	T	A	11: 76,218,450	M60K	probably benign	Het
Dgkg	A	T	16: 22,500,379	L644Q	probably damaging	Het
Disp3	T	C	4: 148,249,825	I1004V	probably benign	Het
Egf	T	A	3: 129,713,006	I599F	probably damaging	Het
Epc2	A	G	2: 49,536,663	T145A	probably damaging	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Extl3	A	T	14: 65,075,867	V622E	probably benign	Het
Fam227a	C	T	15: 79,626,245	V403I	probably benign	Het
Fat2	T	A	11: 55,262,673	D3571V	probably benign	Het
Fcho2	A	G	13: 98,749,850		probably null	Het
Fras1	A	G	5: 96,528,586	N64S	possibly damaging	Het
Gabbr1	A	G	17: 37,055,940	N352S	possibly damaging	Het
Gabra1	T	C	11: 42,154,944	N113S	probably damaging	Het
Glg1	T	C	8: 111,197,675	Y227C	probably damaging	Het
Gm14851	T	A	8: 21,095,201	Q75L	probably benign	Het
Gm5141	A	T	13: 62,774,270	C362S	probably damaging	Het
Gprc6a	T	A	10: 51,628,437	T104S	probably benign	Het
Jph1	A	C	1: 17,091,652	V262G	probably benign	Het
Kank1	C	G	19: 25,410,349	T434R	probably damaging	Het
Kmt2e	A	G	5: 23,499,327	S1173G	possibly damaging	Het
Krt75	G	A	15: 101,573,873		probably benign	Het
Lyzl1	G	T	18: 4,181,192	W77L	probably null	Het
Nipbl	T	G	15: 8,351,280	N676T	probably benign	Het
Obscn	C	T	11: 59,080,160	S2300N	probably damaging	Het
Olfr459	T	G	6: 41,771,903	Y132S	probably damaging	Het
Osbpl1a	T	A	18: 12,758,839	M350L	probably benign	Het
Pecam1	T	C	11: 106,688,856	D460G	probably damaging	Het
Prdm12	T	A	2: 31,640,193	I32N	probably damaging	Het
Prkd1	T	C	12: 50,366,352	S679G	probably damaging	Het
Psen2	C	T	1: 180,228,854	A393T	probably damaging	Het
Ptprh	T	A	7: 4,580,889	T235S	probably benign	Het
Ranbp3	C	T	17: 56,705,527	P182L	probably benign	Het
Serpinb7	A	T	1: 107,451,660	K266*	probably null	Het
Sesn3	T	C	9: 14,308,521	S69P	probably damaging	Het
Slc12a6	T	C	2: 112,354,190	M818T	probably damaging	Het
Slc25a53	C	A	X: 137,015,335	C4F	unknown	Het
Snx1	T	A	9: 66,096,597	L255F	probably benign	Het
Sptbn2	T	G	19: 4,718,976	S46A	possibly damaging	Het
Taf4	A	G	2: 179,933,027	F595S	probably damaging	Het
Tec	A	T	5: 72,786,755	V103E	probably damaging	Het
Tmco5b	T	C	2: 113,290,791	S147P	possibly damaging	Het
Uchl5	C	T	1: 143,799,937	T93I	possibly damaging	Het
Usp14	A	T	18: 10,004,994	S225T	probably benign	Het
Usp45	C	A	4: 21,797,385	Q238K	possibly damaging	Het
Vmn1r6	T	A	6: 57,003,073	M218K	possibly damaging	Het
Zfp84	T	A	7: 29,777,303	Y473*	probably null	Het
Zyg11b	G	A	4: 108,266,213	P186S	probably damaging	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	116354072	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	116346247	splice site	probably benign
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116418520	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7153:Pik3c2a	UTSW	7	116342252	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	116388096	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	116346192	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGAGCCAGTTCTACTTGGTAGTGAT -3'
(R):5'- acgtatgcacaCACCTTTGTACACAT -3'

Sequencing Primer
(F):5'- CTTGGTAGTGATAGGAATCTAAGAGC -3'
(R):5'- ttgtatggatggatggatggg -3'

Posted On

2014-04-13