Incidental Mutation 'R1495:Cdh3'
ID168786
Institutional Source Beutler Lab
Gene Symbol Cdh3
Ensembl Gene ENSMUSG00000061048
Gene Namecadherin 3
SynonymsPcad, P-cadherin, Cadp
MMRRC Submission 039546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1495 (G1)
Quality Score154
Status Not validated
Chromosome8
Chromosomal Location106510891-106557297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106538997 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 224 (T224I)
Ref Sequence ENSEMBL: ENSMUSP00000079613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080797]
PDB Structure
Crystal structure of mouse P-cadherin extracellular domains EC1-EC2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000080797
AA Change: T224I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079613
Gene: ENSMUSG00000061048
AA Change: T224I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 122 205 7.57e-11 SMART
CA 229 318 1.68e-26 SMART
CA 341 431 4.21e-18 SMART
CA 454 538 1.28e-22 SMART
Pfam:Cadherin_C 673 818 3.9e-46 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent cell-cell adhesion protein containing five cadherin domains. The encoded protein plays a role in epithelial outgrowth, such as that which occurs during the development of hair follicles and limb buds. Loss of function of the related gene in humans results in ectodermal dysplasia, ectrodactyly, and macular dystrophy and congential hypotrichosis with juvenile macular dystrophy. This gene is located in the vicinity of similar cadherin genes on chromosome 8. The proprotein is further cleaved into a functional chain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutation of this gene results in precocious development of mammary glands in virgin 10-week old females. Aged virgin females (24 weeks) exhibit alveolar hyperplasia, ductal dysplasia, and extensive lymphocyte infiltration of the mammary glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,477,820 N488S probably benign Het
A430105I19Rik T G 2: 118,760,532 K173N probably damaging Het
Acot10 G A 15: 20,665,507 R383C probably damaging Het
Acsm2 A G 7: 119,578,126 D263G probably damaging Het
Adcy2 G T 13: 68,796,535 Q243K probably benign Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Agt A G 8: 124,559,455 F296S probably damaging Het
Akap14 T C X: 37,163,965 D39G possibly damaging Het
Akt3 T C 1: 177,103,042 M117V probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Arvcf T A 16: 18,389,386 L70Q probably damaging Het
Ccdc171 A T 4: 83,681,095 K724* probably null Het
Ccdc91 A G 6: 147,534,172 T85A possibly damaging Het
Clstn3 T C 6: 124,449,917 I482V probably benign Het
Cnot9 A G 1: 74,523,600 E176G probably damaging Het
Cntnap4 T G 8: 112,881,763 L1272V possibly damaging Het
Cyb5a T A 18: 84,851,480 M1K probably null Het
Cyp2c23 A G 19: 44,005,508 I473T probably benign Het
Dbil5 T A 11: 76,218,450 M60K probably benign Het
Dgkg A T 16: 22,500,379 L644Q probably damaging Het
Disp3 T C 4: 148,249,825 I1004V probably benign Het
Egf T A 3: 129,713,006 I599F probably damaging Het
Epc2 A G 2: 49,536,663 T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Extl3 A T 14: 65,075,867 V622E probably benign Het
Fam227a C T 15: 79,626,245 V403I probably benign Het
Fat2 T A 11: 55,262,673 D3571V probably benign Het
Fcho2 A G 13: 98,749,850 probably null Het
Fras1 A G 5: 96,528,586 N64S possibly damaging Het
Gabbr1 A G 17: 37,055,940 N352S possibly damaging Het
Gabra1 T C 11: 42,154,944 N113S probably damaging Het
Glg1 T C 8: 111,197,675 Y227C probably damaging Het
Gm14851 T A 8: 21,095,201 Q75L probably benign Het
Gm5141 A T 13: 62,774,270 C362S probably damaging Het
Gprc6a T A 10: 51,628,437 T104S probably benign Het
Jph1 A C 1: 17,091,652 V262G probably benign Het
Kank1 C G 19: 25,410,349 T434R probably damaging Het
Kmt2e A G 5: 23,499,327 S1173G possibly damaging Het
Krt75 G A 15: 101,573,873 probably benign Het
Lyzl1 G T 18: 4,181,192 W77L probably null Het
Nipbl T G 15: 8,351,280 N676T probably benign Het
Obscn C T 11: 59,080,160 S2300N probably damaging Het
Olfr459 T G 6: 41,771,903 Y132S probably damaging Het
Osbpl1a T A 18: 12,758,839 M350L probably benign Het
Pecam1 T C 11: 106,688,856 D460G probably damaging Het
Pik3c2a T A 7: 116,388,065 K540N probably benign Het
Prdm12 T A 2: 31,640,193 I32N probably damaging Het
Prkd1 T C 12: 50,366,352 S679G probably damaging Het
Psen2 C T 1: 180,228,854 A393T probably damaging Het
Ptprh T A 7: 4,580,889 T235S probably benign Het
Ranbp3 C T 17: 56,705,527 P182L probably benign Het
Serpinb7 A T 1: 107,451,660 K266* probably null Het
Sesn3 T C 9: 14,308,521 S69P probably damaging Het
Slc12a6 T C 2: 112,354,190 M818T probably damaging Het
Slc25a53 C A X: 137,015,335 C4F unknown Het
Snx1 T A 9: 66,096,597 L255F probably benign Het
Sptbn2 T G 19: 4,718,976 S46A possibly damaging Het
Taf4 A G 2: 179,933,027 F595S probably damaging Het
Tec A T 5: 72,786,755 V103E probably damaging Het
Tmco5b T C 2: 113,290,791 S147P possibly damaging Het
Uchl5 C T 1: 143,799,937 T93I possibly damaging Het
Usp14 A T 18: 10,004,994 S225T probably benign Het
Usp45 C A 4: 21,797,385 Q238K possibly damaging Het
Vmn1r6 T A 6: 57,003,073 M218K possibly damaging Het
Zfp84 T A 7: 29,777,303 Y473* probably null Het
Zyg11b G A 4: 108,266,213 P186S probably damaging Het
Other mutations in Cdh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Cdh3 APN 8 106555305 missense probably damaging 1.00
IGL01431:Cdh3 APN 8 106547669 missense probably damaging 1.00
IGL01466:Cdh3 APN 8 106536595 missense possibly damaging 0.62
IGL01794:Cdh3 APN 8 106537126 missense possibly damaging 0.78
IGL02100:Cdh3 APN 8 106543690 missense probably benign
IGL02272:Cdh3 APN 8 106547836 splice site probably null
IGL02292:Cdh3 APN 8 106545201 missense probably damaging 0.99
IGL02553:Cdh3 APN 8 106544248 nonsense probably null
IGL03245:Cdh3 APN 8 106552999 missense probably damaging 1.00
IGL03376:Cdh3 APN 8 106541404 missense probably benign 0.01
PIT4486001:Cdh3 UTSW 8 106541490 missense possibly damaging 0.89
R0143:Cdh3 UTSW 8 106511225 missense probably benign 0.35
R0388:Cdh3 UTSW 8 106539129 missense probably damaging 1.00
R0462:Cdh3 UTSW 8 106555380 missense possibly damaging 0.65
R0526:Cdh3 UTSW 8 106555446 missense possibly damaging 0.69
R0788:Cdh3 UTSW 8 106541415 missense probably benign 0.05
R1653:Cdh3 UTSW 8 106539068 missense probably damaging 1.00
R1806:Cdh3 UTSW 8 106536915 missense probably benign 0.02
R2124:Cdh3 UTSW 8 106552888 missense probably damaging 1.00
R2302:Cdh3 UTSW 8 106545069 missense probably damaging 1.00
R2326:Cdh3 UTSW 8 106511308 missense probably benign
R2508:Cdh3 UTSW 8 106552407 missense probably damaging 1.00
R3625:Cdh3 UTSW 8 106543678 missense probably damaging 0.98
R3767:Cdh3 UTSW 8 106536974 splice site probably null
R4679:Cdh3 UTSW 8 106539856 missense probably damaging 1.00
R4716:Cdh3 UTSW 8 106543888 missense probably benign
R4778:Cdh3 UTSW 8 106543826 missense probably damaging 0.98
R4928:Cdh3 UTSW 8 106536610 missense probably benign 0.15
R5069:Cdh3 UTSW 8 106536826 missense probably benign 0.19
R5101:Cdh3 UTSW 8 106541392 missense possibly damaging 0.60
R5204:Cdh3 UTSW 8 106544239 missense probably benign 0.29
R5309:Cdh3 UTSW 8 106539020 missense probably damaging 0.98
R5343:Cdh3 UTSW 8 106552936 missense probably benign
R5408:Cdh3 UTSW 8 106536637 missense probably damaging 0.98
R6253:Cdh3 UTSW 8 106537063 splice site probably null
R6637:Cdh3 UTSW 8 106511341 missense probably benign
R6639:Cdh3 UTSW 8 106511341 missense probably benign
R7142:Cdh3 UTSW 8 106545228 critical splice donor site probably null
R7371:Cdh3 UTSW 8 106552477 missense probably damaging 1.00
R7397:Cdh3 UTSW 8 106536609 nonsense probably null
R7458:Cdh3 UTSW 8 106537147 missense probably damaging 1.00
R7512:Cdh3 UTSW 8 106539008 nonsense probably null
R7522:Cdh3 UTSW 8 106541373 missense probably damaging 1.00
R7586:Cdh3 UTSW 8 106511343 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCAAGTTCCAGGAAACAGGC -3'
(R):5'- CCAGGCGACATGCAAACTAAATGAG -3'

Sequencing Primer
(F):5'- AGGAAACAGGCTGCCAC -3'
(R):5'- GCACAGGTTTCCACTCTGAG -3'
Posted On2014-04-13