Mutagenetix > Incidental Mutation

Incidental Mutation 'R1495:Snx1'

168792

Institutional Source

Beutler Lab

Gene Symbol

Snx1

Ensembl Gene

ENSMUSG00000032382

Gene Name

sorting nexin 1

Synonyms

MMRRC Submission

039546-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66088133-66126587 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66096597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 255 (L255F)

Ref Sequence

ENSEMBL: ENSMUSP00000034946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034946] [ENSMUST00000137542]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034946
AA Change: L255F

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034946
Gene: ENSMUSG00000032382
AA Change: L255F

Domain	Start	End	E-Value	Type
Pfam:Sorting_nexin	10	137	2.6e-29	PFAM
PX	140	267	7.59e-40	SMART
Pfam:Vps5	283	516	3.2e-86	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137542

SMART Domains

Protein: ENSMUSP00000120746
Gene: ENSMUSG00000032382

Domain	Start	End	E-Value	Type
Pfam:Sorting_nexin	3	89	6.9e-25	PFAM
PX	92	192	2.37e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143148

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This endosomal protein regulates the cell-surface expression of epidermal growth factor receptor. This protein also has a role in sorting protease-activated receptor-1 from early endosomes to lysosomes. This protein may form oligomeric complexes with family members. This gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,477,820	N488S	probably benign	Het
A430105I19Rik	T	G	2: 118,760,532	K173N	probably damaging	Het
Acot10	G	A	15: 20,665,507	R383C	probably damaging	Het
Acsm2	A	G	7: 119,578,126	D263G	probably damaging	Het
Adcy2	G	T	13: 68,796,535	Q243K	probably benign	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Agt	A	G	8: 124,559,455	F296S	probably damaging	Het
Akap14	T	C	X: 37,163,965	D39G	possibly damaging	Het
Akt3	T	C	1: 177,103,042	M117V	probably benign	Het
Ankar	T	C	1: 72,643,291	T1154A	probably benign	Het
Arvcf	T	A	16: 18,389,386	L70Q	probably damaging	Het
Ccdc171	A	T	4: 83,681,095	K724*	probably null	Het
Ccdc91	A	G	6: 147,534,172	T85A	possibly damaging	Het
Cdh3	C	T	8: 106,538,997	T224I	probably damaging	Het
Clstn3	T	C	6: 124,449,917	I482V	probably benign	Het
Cnot9	A	G	1: 74,523,600	E176G	probably damaging	Het
Cntnap4	T	G	8: 112,881,763	L1272V	possibly damaging	Het
Cyb5a	T	A	18: 84,851,480	M1K	probably null	Het
Cyp2c23	A	G	19: 44,005,508	I473T	probably benign	Het
Dbil5	T	A	11: 76,218,450	M60K	probably benign	Het
Dgkg	A	T	16: 22,500,379	L644Q	probably damaging	Het
Disp3	T	C	4: 148,249,825	I1004V	probably benign	Het
Egf	T	A	3: 129,713,006	I599F	probably damaging	Het
Epc2	A	G	2: 49,536,663	T145A	probably damaging	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Extl3	A	T	14: 65,075,867	V622E	probably benign	Het
Fam227a	C	T	15: 79,626,245	V403I	probably benign	Het
Fat2	T	A	11: 55,262,673	D3571V	probably benign	Het
Fcho2	A	G	13: 98,749,850		probably null	Het
Fras1	A	G	5: 96,528,586	N64S	possibly damaging	Het
Gabbr1	A	G	17: 37,055,940	N352S	possibly damaging	Het
Gabra1	T	C	11: 42,154,944	N113S	probably damaging	Het
Glg1	T	C	8: 111,197,675	Y227C	probably damaging	Het
Gm14851	T	A	8: 21,095,201	Q75L	probably benign	Het
Gm5141	A	T	13: 62,774,270	C362S	probably damaging	Het
Gprc6a	T	A	10: 51,628,437	T104S	probably benign	Het
Jph1	A	C	1: 17,091,652	V262G	probably benign	Het
Kank1	C	G	19: 25,410,349	T434R	probably damaging	Het
Kmt2e	A	G	5: 23,499,327	S1173G	possibly damaging	Het
Krt75	G	A	15: 101,573,873		probably benign	Het
Lyzl1	G	T	18: 4,181,192	W77L	probably null	Het
Nipbl	T	G	15: 8,351,280	N676T	probably benign	Het
Obscn	C	T	11: 59,080,160	S2300N	probably damaging	Het
Olfr459	T	G	6: 41,771,903	Y132S	probably damaging	Het
Osbpl1a	T	A	18: 12,758,839	M350L	probably benign	Het
Pecam1	T	C	11: 106,688,856	D460G	probably damaging	Het
Pik3c2a	T	A	7: 116,388,065	K540N	probably benign	Het
Prdm12	T	A	2: 31,640,193	I32N	probably damaging	Het
Prkd1	T	C	12: 50,366,352	S679G	probably damaging	Het
Psen2	C	T	1: 180,228,854	A393T	probably damaging	Het
Ptprh	T	A	7: 4,580,889	T235S	probably benign	Het
Ranbp3	C	T	17: 56,705,527	P182L	probably benign	Het
Serpinb7	A	T	1: 107,451,660	K266*	probably null	Het
Sesn3	T	C	9: 14,308,521	S69P	probably damaging	Het
Slc12a6	T	C	2: 112,354,190	M818T	probably damaging	Het
Slc25a53	C	A	X: 137,015,335	C4F	unknown	Het
Sptbn2	T	G	19: 4,718,976	S46A	possibly damaging	Het
Taf4	A	G	2: 179,933,027	F595S	probably damaging	Het
Tec	A	T	5: 72,786,755	V103E	probably damaging	Het
Tmco5b	T	C	2: 113,290,791	S147P	possibly damaging	Het
Uchl5	C	T	1: 143,799,937	T93I	possibly damaging	Het
Usp14	A	T	18: 10,004,994	S225T	probably benign	Het
Usp45	C	A	4: 21,797,385	Q238K	possibly damaging	Het
Vmn1r6	T	A	6: 57,003,073	M218K	possibly damaging	Het
Zfp84	T	A	7: 29,777,303	Y473*	probably null	Het
Zyg11b	G	A	4: 108,266,213	P186S	probably damaging	Het

Other mutations in Snx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Snx1	APN	9	66089585	nonsense	probably null
IGL01015:Snx1	APN	9	66094431	missense	possibly damaging	0.72
IGL02070:Snx1	APN	9	66098449	missense	probably damaging	0.97
IGL02225:Snx1	APN	9	66109621	missense	probably benign	0.03
IGL02984:Snx1	APN	9	66089108	splice site	probably benign
IGL03069:Snx1	APN	9	66094624	missense	probably benign
IGL03188:Snx1	APN	9	66094452	missense	probably damaging	1.00
FR4589:Snx1	UTSW	9	66104926	small insertion	probably benign
FR4976:Snx1	UTSW	9	66104929	small insertion	probably benign
FR4976:Snx1	UTSW	9	66104930	small insertion	probably benign
R0116:Snx1	UTSW	9	66088539	nonsense	probably null
R0243:Snx1	UTSW	9	66101326	splice site	probably benign
R0755:Snx1	UTSW	9	66098456	missense	probably damaging	1.00
R0981:Snx1	UTSW	9	66109559	missense	probably benign
R1528:Snx1	UTSW	9	66109543	missense	probably damaging	1.00
R1725:Snx1	UTSW	9	66098329	critical splice donor site	probably null
R3752:Snx1	UTSW	9	66105651	splice site	probably null
R4487:Snx1	UTSW	9	66089595	missense	possibly damaging	0.90
R4778:Snx1	UTSW	9	66101416	intron	probably benign
R4975:Snx1	UTSW	9	66104905	nonsense	probably null
R5043:Snx1	UTSW	9	66097436	missense	probably benign	0.04
R6346:Snx1	UTSW	9	66094648	missense	possibly damaging	0.62
R8063:Snx1	UTSW	9	66097394	unclassified	probably benign
R9679:Snx1	UTSW	9	66090720	missense	probably benign	0.14
RF045:Snx1	UTSW	9	66104922	small insertion	probably benign
T0722:Snx1	UTSW	9	66104927	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGGGTCACGCAAACTCACTG -3'
(R):5'- CCCACTGAACGTCATATTTCCTTCTTGA -3'

Sequencing Primer
(F):5'- CACTGGCTACAGCATTTGAG -3'
(R):5'- acccctttaatcccagcac -3'

Posted On

2014-04-13