Incidental Mutation 'R1495:Fcho2'
ID 168805
Institutional Source Beutler Lab
Gene Symbol Fcho2
Ensembl Gene ENSMUSG00000041685
Gene Name FCH domain only 2
Synonyms 5832424M12Rik
MMRRC Submission 039546-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1495 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 98859911-98951957 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 98886358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040340] [ENSMUST00000099277] [ENSMUST00000109403] [ENSMUST00000179563] [ENSMUST00000224992]
AlphaFold Q3UQN2
Predicted Effect probably null
Transcript: ENSMUST00000040340
SMART Domains Protein: ENSMUSP00000042959
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
low complexity region 503 520 N/A INTRINSIC
Pfam:muHD 542 808 2.5e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099277
SMART Domains Protein: ENSMUSP00000096883
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 342 352 N/A INTRINSIC
low complexity region 434 457 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 504 521 N/A INTRINSIC
Pfam:muHD 543 803 4.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109403
SMART Domains Protein: ENSMUSP00000105030
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179563
SMART Domains Protein: ENSMUSP00000137422
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223634
Predicted Effect probably benign
Transcript: ENSMUST00000224992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225945
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,614,356 (GRCm39) N488S probably benign Het
Acot10 G A 15: 20,665,593 (GRCm39) R383C probably damaging Het
Acsm2 A G 7: 119,177,349 (GRCm39) D263G probably damaging Het
Adcy2 G T 13: 68,944,654 (GRCm39) Q243K probably benign Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Agt A G 8: 125,286,194 (GRCm39) F296S probably damaging Het
Akap14 T C X: 36,427,618 (GRCm39) D39G possibly damaging Het
Akt3 T C 1: 176,930,608 (GRCm39) M117V probably benign Het
Ankar T C 1: 72,682,450 (GRCm39) T1154A probably benign Het
Arvcf T A 16: 18,207,251 (GRCm39) L70Q probably damaging Het
Ccdc171 A T 4: 83,599,332 (GRCm39) K724* probably null Het
Ccdc91 A G 6: 147,435,670 (GRCm39) T85A possibly damaging Het
Ccdc9b T G 2: 118,591,013 (GRCm39) K173N probably damaging Het
Cdh3 C T 8: 107,265,629 (GRCm39) T224I probably damaging Het
Clstn3 T C 6: 124,426,876 (GRCm39) I482V probably benign Het
Cnot9 A G 1: 74,562,759 (GRCm39) E176G probably damaging Het
Cntnap4 T G 8: 113,608,395 (GRCm39) L1272V possibly damaging Het
Cyb5a T A 18: 84,869,605 (GRCm39) M1K probably null Het
Cyp2c23 A G 19: 43,993,947 (GRCm39) I473T probably benign Het
Dbil5 T A 11: 76,109,276 (GRCm39) M60K probably benign Het
Defa38 T A 8: 21,585,217 (GRCm39) Q75L probably benign Het
Dgkg A T 16: 22,319,129 (GRCm39) L644Q probably damaging Het
Disp3 T C 4: 148,334,282 (GRCm39) I1004V probably benign Het
Egf T A 3: 129,506,655 (GRCm39) I599F probably damaging Het
Epc2 A G 2: 49,426,675 (GRCm39) T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Extl3 A T 14: 65,313,316 (GRCm39) V622E probably benign Het
Fam227a C T 15: 79,510,446 (GRCm39) V403I probably benign Het
Fat2 T A 11: 55,153,499 (GRCm39) D3571V probably benign Het
Fras1 A G 5: 96,676,445 (GRCm39) N64S possibly damaging Het
Gabbr1 A G 17: 37,366,832 (GRCm39) N352S possibly damaging Het
Gabra1 T C 11: 42,045,771 (GRCm39) N113S probably damaging Het
Glg1 T C 8: 111,924,307 (GRCm39) Y227C probably damaging Het
Gm5141 A T 13: 62,922,084 (GRCm39) C362S probably damaging Het
Gprc6a T A 10: 51,504,533 (GRCm39) T104S probably benign Het
Jph1 A C 1: 17,161,876 (GRCm39) V262G probably benign Het
Kank1 C G 19: 25,387,713 (GRCm39) T434R probably damaging Het
Kmt2e A G 5: 23,704,325 (GRCm39) S1173G possibly damaging Het
Krt75 G A 15: 101,482,308 (GRCm39) probably benign Het
Lyzl1 G T 18: 4,181,192 (GRCm39) W77L probably null Het
Nipbl T G 15: 8,380,764 (GRCm39) N676T probably benign Het
Obscn C T 11: 58,970,986 (GRCm39) S2300N probably damaging Het
Or9a2 T G 6: 41,748,837 (GRCm39) Y132S probably damaging Het
Osbpl1a T A 18: 12,891,896 (GRCm39) M350L probably benign Het
Pecam1 T C 11: 106,579,682 (GRCm39) D460G probably damaging Het
Pik3c2a T A 7: 115,987,300 (GRCm39) K540N probably benign Het
Prdm12 T A 2: 31,530,205 (GRCm39) I32N probably damaging Het
Prkd1 T C 12: 50,413,135 (GRCm39) S679G probably damaging Het
Psen2 C T 1: 180,056,419 (GRCm39) A393T probably damaging Het
Ptprh T A 7: 4,583,888 (GRCm39) T235S probably benign Het
Ranbp3 C T 17: 57,012,527 (GRCm39) P182L probably benign Het
Serpinb7 A T 1: 107,379,390 (GRCm39) K266* probably null Het
Sesn3 T C 9: 14,219,817 (GRCm39) S69P probably damaging Het
Slc12a6 T C 2: 112,184,535 (GRCm39) M818T probably damaging Het
Slc25a53 C A X: 135,916,084 (GRCm39) C4F unknown Het
Snx1 T A 9: 66,003,879 (GRCm39) L255F probably benign Het
Sptbn2 T G 19: 4,769,004 (GRCm39) S46A possibly damaging Het
Taf4 A G 2: 179,574,820 (GRCm39) F595S probably damaging Het
Tec A T 5: 72,944,098 (GRCm39) V103E probably damaging Het
Tmco5b T C 2: 113,121,136 (GRCm39) S147P possibly damaging Het
Uchl5 C T 1: 143,675,675 (GRCm39) T93I possibly damaging Het
Usp14 A T 18: 10,004,994 (GRCm39) S225T probably benign Het
Usp45 C A 4: 21,797,385 (GRCm39) Q238K possibly damaging Het
Vmn1r6 T A 6: 56,980,058 (GRCm39) M218K possibly damaging Het
Zfp84 T A 7: 29,476,728 (GRCm39) Y473* probably null Het
Zyg11b G A 4: 108,123,410 (GRCm39) P186S probably damaging Het
Other mutations in Fcho2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fcho2 APN 13 98,926,315 (GRCm39) missense probably benign
IGL02058:Fcho2 APN 13 98,867,414 (GRCm39) missense probably damaging 0.98
IGL02516:Fcho2 APN 13 98,866,720 (GRCm39) missense probably benign 0.08
IGL02715:Fcho2 APN 13 98,932,843 (GRCm39) missense probably damaging 1.00
IGL03243:Fcho2 APN 13 98,913,892 (GRCm39) splice site probably benign
R0044:Fcho2 UTSW 13 98,892,052 (GRCm39) intron probably benign
R0087:Fcho2 UTSW 13 98,871,594 (GRCm39) missense probably benign 0.00
R0472:Fcho2 UTSW 13 98,884,775 (GRCm39) missense probably benign 0.01
R0501:Fcho2 UTSW 13 98,901,023 (GRCm39) missense possibly damaging 0.92
R1022:Fcho2 UTSW 13 98,869,167 (GRCm39) missense probably damaging 1.00
R1024:Fcho2 UTSW 13 98,869,167 (GRCm39) missense probably damaging 1.00
R1130:Fcho2 UTSW 13 98,884,797 (GRCm39) missense probably damaging 1.00
R1593:Fcho2 UTSW 13 98,921,315 (GRCm39) missense possibly damaging 0.92
R1608:Fcho2 UTSW 13 98,862,706 (GRCm39) missense probably benign 0.01
R1638:Fcho2 UTSW 13 98,882,403 (GRCm39) missense possibly damaging 0.83
R1643:Fcho2 UTSW 13 98,921,324 (GRCm39) missense probably benign 0.00
R2125:Fcho2 UTSW 13 98,912,406 (GRCm39) missense possibly damaging 0.83
R3117:Fcho2 UTSW 13 98,913,946 (GRCm39) missense probably damaging 1.00
R3968:Fcho2 UTSW 13 98,871,564 (GRCm39) missense probably benign 0.06
R3970:Fcho2 UTSW 13 98,871,564 (GRCm39) missense probably benign 0.06
R4079:Fcho2 UTSW 13 98,892,120 (GRCm39) missense probably damaging 0.99
R4816:Fcho2 UTSW 13 98,942,874 (GRCm39) missense probably damaging 1.00
R5338:Fcho2 UTSW 13 98,867,399 (GRCm39) missense probably damaging 1.00
R5437:Fcho2 UTSW 13 98,913,982 (GRCm39) missense possibly damaging 0.95
R5457:Fcho2 UTSW 13 98,926,275 (GRCm39) missense probably damaging 0.99
R5733:Fcho2 UTSW 13 98,926,310 (GRCm39) missense probably damaging 0.99
R6136:Fcho2 UTSW 13 98,926,275 (GRCm39) missense probably damaging 0.99
R6186:Fcho2 UTSW 13 98,951,591 (GRCm39) missense probably benign 0.01
R6365:Fcho2 UTSW 13 98,926,367 (GRCm39) missense probably benign 0.20
R7041:Fcho2 UTSW 13 98,921,334 (GRCm39) missense possibly damaging 0.72
R7168:Fcho2 UTSW 13 98,925,971 (GRCm39) missense probably benign
R7218:Fcho2 UTSW 13 98,890,121 (GRCm39) splice site probably null
R7243:Fcho2 UTSW 13 98,891,724 (GRCm39) missense possibly damaging 0.94
R7533:Fcho2 UTSW 13 98,921,307 (GRCm39) missense probably benign 0.00
R7757:Fcho2 UTSW 13 98,901,011 (GRCm39) critical splice donor site probably null
R7904:Fcho2 UTSW 13 98,932,871 (GRCm39) missense possibly damaging 0.54
R7993:Fcho2 UTSW 13 98,888,524 (GRCm39) splice site probably null
R8004:Fcho2 UTSW 13 98,926,013 (GRCm39) missense possibly damaging 0.80
R8358:Fcho2 UTSW 13 98,862,282 (GRCm39) nonsense probably null
R8512:Fcho2 UTSW 13 98,891,730 (GRCm39) missense possibly damaging 0.69
R8692:Fcho2 UTSW 13 98,882,382 (GRCm39) frame shift probably null
R8792:Fcho2 UTSW 13 98,951,769 (GRCm39) unclassified probably benign
R8954:Fcho2 UTSW 13 98,913,985 (GRCm39) missense probably benign 0.05
R8969:Fcho2 UTSW 13 98,891,604 (GRCm39) nonsense probably null
R9091:Fcho2 UTSW 13 98,925,869 (GRCm39) critical splice donor site probably null
R9092:Fcho2 UTSW 13 98,886,391 (GRCm39) missense probably benign 0.01
R9171:Fcho2 UTSW 13 98,891,607 (GRCm39) missense probably benign
R9270:Fcho2 UTSW 13 98,925,869 (GRCm39) critical splice donor site probably null
R9668:Fcho2 UTSW 13 98,913,965 (GRCm39) missense probably benign 0.12
R9672:Fcho2 UTSW 13 98,869,178 (GRCm39) nonsense probably null
R9717:Fcho2 UTSW 13 98,900,202 (GRCm39) missense probably damaging 1.00
X0018:Fcho2 UTSW 13 98,868,590 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGAGGGACTAGGCAG -3'
(R):5'- GCTAGGACCTCCTTCAGTAGCTCATCA -3'

Sequencing Primer
(F):5'- acacgactgagattgaccc -3'
(R):5'- atttcacctgtctctgccc -3'
Posted On 2014-04-13