Incidental Mutation 'R1495:Acot10'
ID 168809
Institutional Source Beutler Lab
Gene Symbol Acot10
Ensembl Gene ENSMUSG00000047565
Gene Name acyl-CoA thioesterase 10
Synonyms MT-ACT48, p48, Acate3
MMRRC Submission 039546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R1495 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 20665214-20666750 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20665507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 383 (R383C)
Ref Sequence ENSEMBL: ENSMUSP00000051333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052910]
AlphaFold Q32MW3
Predicted Effect probably damaging
Transcript: ENSMUST00000052910
AA Change: R383C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051333
Gene: ENSMUSG00000047565
AA Change: R383C

DomainStartEndE-ValueType
SCOP:d1lo7a_ 108 222 1e-4 SMART
PDB:4IEN|D 277 400 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228652
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,477,820 N488S probably benign Het
A430105I19Rik T G 2: 118,760,532 K173N probably damaging Het
Acsm2 A G 7: 119,578,126 D263G probably damaging Het
Adcy2 G T 13: 68,796,535 Q243K probably benign Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Agt A G 8: 124,559,455 F296S probably damaging Het
Akap14 T C X: 37,163,965 D39G possibly damaging Het
Akt3 T C 1: 177,103,042 M117V probably benign Het
Ankar T C 1: 72,643,291 T1154A probably benign Het
Arvcf T A 16: 18,389,386 L70Q probably damaging Het
Ccdc171 A T 4: 83,681,095 K724* probably null Het
Ccdc91 A G 6: 147,534,172 T85A possibly damaging Het
Cdh3 C T 8: 106,538,997 T224I probably damaging Het
Clstn3 T C 6: 124,449,917 I482V probably benign Het
Cnot9 A G 1: 74,523,600 E176G probably damaging Het
Cntnap4 T G 8: 112,881,763 L1272V possibly damaging Het
Cyb5a T A 18: 84,851,480 M1K probably null Het
Cyp2c23 A G 19: 44,005,508 I473T probably benign Het
Dbil5 T A 11: 76,218,450 M60K probably benign Het
Dgkg A T 16: 22,500,379 L644Q probably damaging Het
Disp3 T C 4: 148,249,825 I1004V probably benign Het
Egf T A 3: 129,713,006 I599F probably damaging Het
Epc2 A G 2: 49,536,663 T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Extl3 A T 14: 65,075,867 V622E probably benign Het
Fam227a C T 15: 79,626,245 V403I probably benign Het
Fat2 T A 11: 55,262,673 D3571V probably benign Het
Fcho2 A G 13: 98,749,850 probably null Het
Fras1 A G 5: 96,528,586 N64S possibly damaging Het
Gabbr1 A G 17: 37,055,940 N352S possibly damaging Het
Gabra1 T C 11: 42,154,944 N113S probably damaging Het
Glg1 T C 8: 111,197,675 Y227C probably damaging Het
Gm14851 T A 8: 21,095,201 Q75L probably benign Het
Gm5141 A T 13: 62,774,270 C362S probably damaging Het
Gprc6a T A 10: 51,628,437 T104S probably benign Het
Jph1 A C 1: 17,091,652 V262G probably benign Het
Kank1 C G 19: 25,410,349 T434R probably damaging Het
Kmt2e A G 5: 23,499,327 S1173G possibly damaging Het
Krt75 G A 15: 101,573,873 probably benign Het
Lyzl1 G T 18: 4,181,192 W77L probably null Het
Nipbl T G 15: 8,351,280 N676T probably benign Het
Obscn C T 11: 59,080,160 S2300N probably damaging Het
Olfr459 T G 6: 41,771,903 Y132S probably damaging Het
Osbpl1a T A 18: 12,758,839 M350L probably benign Het
Pecam1 T C 11: 106,688,856 D460G probably damaging Het
Pik3c2a T A 7: 116,388,065 K540N probably benign Het
Prdm12 T A 2: 31,640,193 I32N probably damaging Het
Prkd1 T C 12: 50,366,352 S679G probably damaging Het
Psen2 C T 1: 180,228,854 A393T probably damaging Het
Ptprh T A 7: 4,580,889 T235S probably benign Het
Ranbp3 C T 17: 56,705,527 P182L probably benign Het
Serpinb7 A T 1: 107,451,660 K266* probably null Het
Sesn3 T C 9: 14,308,521 S69P probably damaging Het
Slc12a6 T C 2: 112,354,190 M818T probably damaging Het
Slc25a53 C A X: 137,015,335 C4F unknown Het
Snx1 T A 9: 66,096,597 L255F probably benign Het
Sptbn2 T G 19: 4,718,976 S46A possibly damaging Het
Taf4 A G 2: 179,933,027 F595S probably damaging Het
Tec A T 5: 72,786,755 V103E probably damaging Het
Tmco5b T C 2: 113,290,791 S147P possibly damaging Het
Uchl5 C T 1: 143,799,937 T93I possibly damaging Het
Usp14 A T 18: 10,004,994 S225T probably benign Het
Usp45 C A 4: 21,797,385 Q238K possibly damaging Het
Vmn1r6 T A 6: 57,003,073 M218K possibly damaging Het
Zfp84 T A 7: 29,777,303 Y473* probably null Het
Zyg11b G A 4: 108,266,213 P186S probably damaging Het
Other mutations in Acot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Acot10 APN 15 20665965 missense probably benign 0.11
IGL01610:Acot10 APN 15 20665695 missense probably damaging 1.00
IGL02457:Acot10 APN 15 20666143 missense possibly damaging 0.88
IGL02587:Acot10 APN 15 20665797 missense possibly damaging 0.93
IGL02951:Acot10 APN 15 20665782 missense probably benign 0.36
ANU23:Acot10 UTSW 15 20665965 missense probably benign 0.11
PIT4151001:Acot10 UTSW 15 20666598 missense probably damaging 0.98
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0462:Acot10 UTSW 15 20666626 missense possibly damaging 0.85
R1312:Acot10 UTSW 15 20666499 missense probably benign 0.00
R2128:Acot10 UTSW 15 20666626 missense probably benign 0.00
R3779:Acot10 UTSW 15 20665542 missense probably damaging 0.98
R4110:Acot10 UTSW 15 20666526 missense probably damaging 1.00
R4111:Acot10 UTSW 15 20666526 missense probably damaging 1.00
R4464:Acot10 UTSW 15 20665744 nonsense probably null
R4668:Acot10 UTSW 15 20665942 missense probably benign
R4933:Acot10 UTSW 15 20666330 missense possibly damaging 0.88
R5255:Acot10 UTSW 15 20665932 missense probably benign 0.01
R5885:Acot10 UTSW 15 20666104 missense probably benign 0.01
R6190:Acot10 UTSW 15 20665785 missense possibly damaging 0.80
R6301:Acot10 UTSW 15 20666262 missense probably benign 0.05
R6805:Acot10 UTSW 15 20665366 missense probably benign 0.42
R7334:Acot10 UTSW 15 20665543 missense possibly damaging 0.86
R7601:Acot10 UTSW 15 20665629 missense probably damaging 1.00
R8400:Acot10 UTSW 15 20666172 missense possibly damaging 0.56
R9195:Acot10 UTSW 15 20665431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGAGTGCTAGTTTGCAACAAGTG -3'
(R):5'- TTGCCTCCTAAGGCAGTGTGGATG -3'

Sequencing Primer
(F):5'- GTTTGCAACAAGTGAGATTTTCC -3'
(R):5'- GCATATGAACTTGCATGGGCTAC -3'
Posted On 2014-04-13