Incidental Mutation 'R1495:Acot10'
ID 168809
Institutional Source Beutler Lab
Gene Symbol Acot10
Ensembl Gene ENSMUSG00000047565
Gene Name acyl-CoA thioesterase 10
Synonyms p48, MT-ACT48, Acate3
MMRRC Submission 039546-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R1495 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 20665300-20666836 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20665593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 383 (R383C)
Ref Sequence ENSEMBL: ENSMUSP00000051333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052910]
AlphaFold Q32MW3
Predicted Effect probably damaging
Transcript: ENSMUST00000052910
AA Change: R383C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051333
Gene: ENSMUSG00000047565
AA Change: R383C

DomainStartEndE-ValueType
SCOP:d1lo7a_ 108 222 1e-4 SMART
PDB:4IEN|D 277 400 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228652
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,614,356 (GRCm39) N488S probably benign Het
Acsm2 A G 7: 119,177,349 (GRCm39) D263G probably damaging Het
Adcy2 G T 13: 68,944,654 (GRCm39) Q243K probably benign Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Agt A G 8: 125,286,194 (GRCm39) F296S probably damaging Het
Akap14 T C X: 36,427,618 (GRCm39) D39G possibly damaging Het
Akt3 T C 1: 176,930,608 (GRCm39) M117V probably benign Het
Ankar T C 1: 72,682,450 (GRCm39) T1154A probably benign Het
Arvcf T A 16: 18,207,251 (GRCm39) L70Q probably damaging Het
Ccdc171 A T 4: 83,599,332 (GRCm39) K724* probably null Het
Ccdc91 A G 6: 147,435,670 (GRCm39) T85A possibly damaging Het
Ccdc9b T G 2: 118,591,013 (GRCm39) K173N probably damaging Het
Cdh3 C T 8: 107,265,629 (GRCm39) T224I probably damaging Het
Clstn3 T C 6: 124,426,876 (GRCm39) I482V probably benign Het
Cnot9 A G 1: 74,562,759 (GRCm39) E176G probably damaging Het
Cntnap4 T G 8: 113,608,395 (GRCm39) L1272V possibly damaging Het
Cyb5a T A 18: 84,869,605 (GRCm39) M1K probably null Het
Cyp2c23 A G 19: 43,993,947 (GRCm39) I473T probably benign Het
Dbil5 T A 11: 76,109,276 (GRCm39) M60K probably benign Het
Defa38 T A 8: 21,585,217 (GRCm39) Q75L probably benign Het
Dgkg A T 16: 22,319,129 (GRCm39) L644Q probably damaging Het
Disp3 T C 4: 148,334,282 (GRCm39) I1004V probably benign Het
Egf T A 3: 129,506,655 (GRCm39) I599F probably damaging Het
Epc2 A G 2: 49,426,675 (GRCm39) T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Extl3 A T 14: 65,313,316 (GRCm39) V622E probably benign Het
Fam227a C T 15: 79,510,446 (GRCm39) V403I probably benign Het
Fat2 T A 11: 55,153,499 (GRCm39) D3571V probably benign Het
Fcho2 A G 13: 98,886,358 (GRCm39) probably null Het
Fras1 A G 5: 96,676,445 (GRCm39) N64S possibly damaging Het
Gabbr1 A G 17: 37,366,832 (GRCm39) N352S possibly damaging Het
Gabra1 T C 11: 42,045,771 (GRCm39) N113S probably damaging Het
Glg1 T C 8: 111,924,307 (GRCm39) Y227C probably damaging Het
Gm5141 A T 13: 62,922,084 (GRCm39) C362S probably damaging Het
Gprc6a T A 10: 51,504,533 (GRCm39) T104S probably benign Het
Jph1 A C 1: 17,161,876 (GRCm39) V262G probably benign Het
Kank1 C G 19: 25,387,713 (GRCm39) T434R probably damaging Het
Kmt2e A G 5: 23,704,325 (GRCm39) S1173G possibly damaging Het
Krt75 G A 15: 101,482,308 (GRCm39) probably benign Het
Lyzl1 G T 18: 4,181,192 (GRCm39) W77L probably null Het
Nipbl T G 15: 8,380,764 (GRCm39) N676T probably benign Het
Obscn C T 11: 58,970,986 (GRCm39) S2300N probably damaging Het
Or9a2 T G 6: 41,748,837 (GRCm39) Y132S probably damaging Het
Osbpl1a T A 18: 12,891,896 (GRCm39) M350L probably benign Het
Pecam1 T C 11: 106,579,682 (GRCm39) D460G probably damaging Het
Pik3c2a T A 7: 115,987,300 (GRCm39) K540N probably benign Het
Prdm12 T A 2: 31,530,205 (GRCm39) I32N probably damaging Het
Prkd1 T C 12: 50,413,135 (GRCm39) S679G probably damaging Het
Psen2 C T 1: 180,056,419 (GRCm39) A393T probably damaging Het
Ptprh T A 7: 4,583,888 (GRCm39) T235S probably benign Het
Ranbp3 C T 17: 57,012,527 (GRCm39) P182L probably benign Het
Serpinb7 A T 1: 107,379,390 (GRCm39) K266* probably null Het
Sesn3 T C 9: 14,219,817 (GRCm39) S69P probably damaging Het
Slc12a6 T C 2: 112,184,535 (GRCm39) M818T probably damaging Het
Slc25a53 C A X: 135,916,084 (GRCm39) C4F unknown Het
Snx1 T A 9: 66,003,879 (GRCm39) L255F probably benign Het
Sptbn2 T G 19: 4,769,004 (GRCm39) S46A possibly damaging Het
Taf4 A G 2: 179,574,820 (GRCm39) F595S probably damaging Het
Tec A T 5: 72,944,098 (GRCm39) V103E probably damaging Het
Tmco5b T C 2: 113,121,136 (GRCm39) S147P possibly damaging Het
Uchl5 C T 1: 143,675,675 (GRCm39) T93I possibly damaging Het
Usp14 A T 18: 10,004,994 (GRCm39) S225T probably benign Het
Usp45 C A 4: 21,797,385 (GRCm39) Q238K possibly damaging Het
Vmn1r6 T A 6: 56,980,058 (GRCm39) M218K possibly damaging Het
Zfp84 T A 7: 29,476,728 (GRCm39) Y473* probably null Het
Zyg11b G A 4: 108,123,410 (GRCm39) P186S probably damaging Het
Other mutations in Acot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Acot10 APN 15 20,666,051 (GRCm39) missense probably benign 0.11
IGL01610:Acot10 APN 15 20,665,781 (GRCm39) missense probably damaging 1.00
IGL02457:Acot10 APN 15 20,666,229 (GRCm39) missense possibly damaging 0.88
IGL02587:Acot10 APN 15 20,665,883 (GRCm39) missense possibly damaging 0.93
IGL02951:Acot10 APN 15 20,665,868 (GRCm39) missense probably benign 0.36
ANU23:Acot10 UTSW 15 20,666,051 (GRCm39) missense probably benign 0.11
PIT4151001:Acot10 UTSW 15 20,666,684 (GRCm39) missense probably damaging 0.98
R0026:Acot10 UTSW 15 20,666,322 (GRCm39) missense probably benign 0.10
R0026:Acot10 UTSW 15 20,666,322 (GRCm39) missense probably benign 0.10
R0462:Acot10 UTSW 15 20,666,712 (GRCm39) missense possibly damaging 0.85
R1312:Acot10 UTSW 15 20,666,585 (GRCm39) missense probably benign 0.00
R2128:Acot10 UTSW 15 20,666,712 (GRCm39) missense probably benign 0.00
R3779:Acot10 UTSW 15 20,665,628 (GRCm39) missense probably damaging 0.98
R4110:Acot10 UTSW 15 20,666,612 (GRCm39) missense probably damaging 1.00
R4111:Acot10 UTSW 15 20,666,612 (GRCm39) missense probably damaging 1.00
R4464:Acot10 UTSW 15 20,665,830 (GRCm39) nonsense probably null
R4668:Acot10 UTSW 15 20,666,028 (GRCm39) missense probably benign
R4933:Acot10 UTSW 15 20,666,416 (GRCm39) missense possibly damaging 0.88
R5255:Acot10 UTSW 15 20,666,018 (GRCm39) missense probably benign 0.01
R5885:Acot10 UTSW 15 20,666,190 (GRCm39) missense probably benign 0.01
R6190:Acot10 UTSW 15 20,665,871 (GRCm39) missense possibly damaging 0.80
R6301:Acot10 UTSW 15 20,666,348 (GRCm39) missense probably benign 0.05
R6805:Acot10 UTSW 15 20,665,452 (GRCm39) missense probably benign 0.42
R7334:Acot10 UTSW 15 20,665,629 (GRCm39) missense possibly damaging 0.86
R7601:Acot10 UTSW 15 20,665,715 (GRCm39) missense probably damaging 1.00
R8400:Acot10 UTSW 15 20,666,258 (GRCm39) missense possibly damaging 0.56
R9195:Acot10 UTSW 15 20,665,517 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGAGTGCTAGTTTGCAACAAGTG -3'
(R):5'- TTGCCTCCTAAGGCAGTGTGGATG -3'

Sequencing Primer
(F):5'- GTTTGCAACAAGTGAGATTTTCC -3'
(R):5'- GCATATGAACTTGCATGGGCTAC -3'
Posted On 2014-04-13